ID: 1127238184

View in Genome Browser
Species Human (GRCh38)
Location 15:57079642-57079664
Sequence GGTGAATGAGTAGCCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127238180_1127238184 24 Left 1127238180 15:57079595-57079617 CCTCCGCTGTGTGATTTTATTCA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 176
1127238179_1127238184 25 Left 1127238179 15:57079594-57079616 CCCTCCGCTGTGTGATTTTATTC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 176
1127238181_1127238184 21 Left 1127238181 15:57079598-57079620 CCGCTGTGTGATTTTATTCAATT 0: 1
1: 0
2: 0
3: 31
4: 474
Right 1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127238184 Original CRISPR GGTGAATGAGTAGCCCCTGG CGG Intronic
902376350 1:16031812-16031834 CGTGACCGAGTATCCCCTGGTGG + Exonic
902574601 1:17369586-17369608 GGTGAATAAGAAGCCCCTGGAGG + Intergenic
902718635 1:18289924-18289946 GGAGAATGGGGAGCCCCTGGAGG + Intronic
903287259 1:22285033-22285055 AGTGAATCAGGAGCTCCTGGGGG - Intergenic
903366811 1:22810405-22810427 GGTGGATGTGAAGCTCCTGGAGG - Intronic
905118932 1:35666825-35666847 GGTGAAAGAGAATCTCCTGGTGG - Intergenic
908400922 1:63772381-63772403 GGTGAATGACTAACCCATGCGGG - Intergenic
908438879 1:64133478-64133500 GGAGAAGGAGGAGACCCTGGAGG + Intronic
910789701 1:91038531-91038553 AGGGAATGAGTAGCCTTTGGAGG - Intergenic
911069765 1:93823381-93823403 GGTGAATGAGGAGAAGCTGGTGG + Intronic
915591656 1:156874396-156874418 GGTGGGTGAGTAGCCCAAGGTGG + Exonic
921328902 1:214015873-214015895 GGTGAATGACTAGCCACTGAGGG - Intronic
921932115 1:220763140-220763162 AGTGAATGACTGGACCCTGGCGG - Intronic
922132015 1:222789151-222789173 AGTGCATGAGAAGCCCTTGGAGG + Intergenic
923124390 1:231022618-231022640 GGTGCAAGAGTGGCCCCTTGAGG + Intronic
924727659 1:246685115-246685137 GATGTATGATTAGACCCTGGAGG - Intergenic
924783803 1:247175856-247175878 GCTGAGTGAGCAGCCACTGGTGG - Intergenic
1063476391 10:6332423-6332445 GGGGAGGGAGTTGCCCCTGGTGG - Intergenic
1067101248 10:43336273-43336295 GCTGCCTGTGTAGCCCCTGGAGG - Intergenic
1067577122 10:47415929-47415951 GGTGGATGAGTGGCCTGTGGTGG - Intergenic
1067577152 10:47416091-47416113 GGTGAATGGGTGGCCTGTGGTGG - Intergenic
1071477831 10:86039970-86039992 TGTGGATCAGAAGCCCCTGGAGG + Intronic
1073144429 10:101271252-101271274 GGGGAATCAGGAGCCCCAGGAGG + Intergenic
1073945105 10:108741105-108741127 AGTGAATGAGAGGCCCCTGGGGG - Intergenic
1075623890 10:123948072-123948094 GGTGAATGGGAAACACCTGGAGG - Intergenic
1076136565 10:128049242-128049264 GGTGGATGAGTGGCCTCGGGAGG + Intronic
1076894650 10:133303983-133304005 GGCTAATGAGCAGCCACTGGTGG - Intronic
1081764524 11:45600352-45600374 GGGCAATGAGAAGACCCTGGAGG - Intergenic
1084138457 11:67206051-67206073 GGAGAATGAGTATCACCTTGTGG - Intronic
1084360326 11:68664870-68664892 GGTGTATGAGTGGCCCCTTGGGG + Intergenic
1084562162 11:69911206-69911228 AGGGAAGGAGTGGCCCCTGGTGG - Intergenic
1087304404 11:96472265-96472287 GGTAAATGAGTGACCCCTAGTGG + Intronic
1089052889 11:115561371-115561393 GGGGAATGAGTAGACCAGGGTGG - Intergenic
1090445973 11:126765138-126765160 GGTAACTGAGAAGCCCCTGATGG + Intronic
1091361026 11:134978577-134978599 AGTGACTGAGTACCCCCAGGTGG + Intergenic
1091595708 12:1877770-1877792 AGTGCATGACTAGCTCCTGGAGG + Intronic
1093934826 12:24989528-24989550 GGTGAATGAAAAGCCCCTTAGGG - Intergenic
1094819150 12:34211355-34211377 GGTGCATGTCTAGCCCATGGGGG - Intergenic
1095422387 12:42039011-42039033 GTTAAGTGAGTAGACCCTGGAGG - Intergenic
1096113964 12:49044322-49044344 TGTGGATGAGAAGCCGCTGGGGG + Intronic
1101864706 12:108512112-108512134 GGTGAATTACTGCCCCCTGGTGG + Intergenic
1102196868 12:111032696-111032718 GGAGTATGAGTTCCCCCTGGAGG + Intergenic
1102405631 12:112671771-112671793 AGTACATGAGTAGCCTCTGGAGG + Intronic
1102907628 12:116688871-116688893 GGTGGGTGGGTATCCCCTGGTGG + Intergenic
1103611804 12:122128698-122128720 GTTGGATGAGAGGCCCCTGGAGG + Intronic
1103618469 12:122170851-122170873 GGTGTATTAGAATCCCCTGGAGG + Intronic
1103904618 12:124321030-124321052 TGTGAGTGGGTAACCCCTGGCGG + Intergenic
1104004655 12:124883522-124883544 AGTGAGTCAGAAGCCCCTGGAGG - Intergenic
1104043597 12:125146117-125146139 GGTGAATGGGTAGGCCAGGGCGG + Intergenic
1105204133 13:18205820-18205842 GTTGACTGGGTAGCCCCTGAGGG - Intergenic
1108522576 13:51259317-51259339 TGTGGATGAGCAGCCGCTGGAGG - Intronic
1109934712 13:69265529-69265551 AGTGAGTGAGAGGCCCCTGGGGG - Intergenic
1112174744 13:97010865-97010887 GCTGAAGGAGTAGCAGCTGGAGG - Intergenic
1113778395 13:112961867-112961889 GGTGAATGAGTGGCCTCTCGTGG - Intronic
1114062224 14:19028081-19028103 GGAGATGGAGGAGCCCCTGGGGG - Intergenic
1114100036 14:19371912-19371934 GGAGATGGAGGAGCCCCTGGGGG + Intergenic
1114696299 14:24630599-24630621 GGAGAATGAGGAGCCCCAGTGGG + Intergenic
1115769537 14:36655763-36655785 TGTCCTTGAGTAGCCCCTGGGGG + Intergenic
1116814424 14:49570304-49570326 GGTAAATCAGCAGGCCCTGGTGG + Intergenic
1116845571 14:49862181-49862203 GGTAAACGAGCAGCCCCTGTTGG + Intergenic
1121258185 14:92546793-92546815 GGGGAATGAGATGTCCCTGGTGG + Intronic
1121301931 14:92878725-92878747 GGTTGATGAGTATCACCTGGGGG - Intergenic
1121320940 14:92991281-92991303 GGTGAATGGACAGCCACTGGGGG + Intronic
1121397846 14:93642583-93642605 GGTCATTGAGTTGCCCATGGAGG + Intronic
1123142541 14:106095004-106095026 GGTTAATGAGCGCCCCCTGGTGG + Intergenic
1124090123 15:26591448-26591470 GGTGAATGAGTAGTCCCATCAGG + Intronic
1124661472 15:31553931-31553953 GGTAGATAAGCAGCCCCTGGAGG - Intronic
1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG + Intronic
1135631709 16:24040647-24040669 TATGAATGAGAAACCCCTGGAGG + Intronic
1136014052 16:27383612-27383634 GGTGTCTGAGAAGGCCCTGGAGG - Intergenic
1136613818 16:31383227-31383249 GGTGGAAAAGTAGCCACTGGAGG - Intergenic
1136653850 16:31697079-31697101 GGTAAGTGAGCATCCCCTGGTGG + Intergenic
1136672425 16:31870544-31870566 AGTGAGTGAGCAGTCCCTGGTGG + Intergenic
1137776823 16:51062251-51062273 GGTGAGTGAGTAGCCACCAGGGG + Intergenic
1138793608 16:59940001-59940023 AGTGAGTGAGAAGCTCCTGGTGG - Intergenic
1141468539 16:84222822-84222844 GGTGTCTGAGGAGCCCCCGGAGG - Exonic
1142419416 16:89961310-89961332 GGTCACTGAGGAGCACCTGGAGG + Intronic
1142641434 17:1288247-1288269 GGGGGATGAGGAGCCCGTGGGGG - Intronic
1142641465 17:1288320-1288342 GGGGGATGAGGAGCCCGTGGGGG - Intronic
1142641490 17:1288374-1288396 GGGGGATGAGGAGCCCATGGGGG - Intronic
1142641620 17:1288681-1288703 GGGGGATGAGGAGCCCGTGGGGG - Intronic
1142641696 17:1288844-1288866 GGGGGATGAGGAGCCCGTGGGGG - Intronic
1142641898 17:1289285-1289307 GGGGGATGGGGAGCCCCTGGGGG - Intronic
1142641958 17:1289430-1289452 GGGGGATGAGGAGCCCGTGGGGG - Intronic
1143187588 17:5019952-5019974 GGGGAAAGATTAGACCCTGGAGG - Intronic
1143359493 17:6356898-6356920 TGAGCATGAGTAGCCCCAGGGGG + Intergenic
1144699089 17:17325104-17325126 GGTGTATGAGAATCACCTGGCGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146932829 17:36790289-36790311 AGAGAATGAGGAGCCACTGGAGG + Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147133783 17:38423834-38423856 GGAGAAAGAGCATCCCCTGGTGG - Intergenic
1147416113 17:40291408-40291430 GGTGAATGAGAAGACCCAGTGGG - Intronic
1148148911 17:45384634-45384656 AATGAATGAGAAGCCTCTGGAGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149991776 17:61387561-61387583 GATGAATGAGTAGCAACTGAAGG - Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151269705 17:72984647-72984669 AGTGCATGAGAATCCCCTGGAGG - Intronic
1162514944 19:11142298-11142320 TGTATATCAGTAGCCCCTGGAGG - Intronic
1162833237 19:13299746-13299768 GGTGAGGGAGGAGCCACTGGGGG - Intronic
1166792993 19:45408904-45408926 GGTGAAGGTGGAGCCACTGGAGG + Exonic
1167294205 19:48639868-48639890 AGTGAATGAGCTGCACCTGGGGG + Exonic
1168504281 19:56920120-56920142 AGTGAATGAGAAGACCCAGGAGG - Intergenic
926156061 2:10454603-10454625 GGTGAAGTAGCAGCCCCTGGGGG - Intergenic
926172403 2:10560609-10560631 GGTGCATCAGAAGCCCCTGGAGG - Intergenic
926990944 2:18679177-18679199 GGGGAAGGTGTAGTCCCTGGTGG + Intergenic
933700953 2:85255249-85255271 GGTGCATGAGCATCACCTGGAGG + Intronic
940460501 2:153958241-153958263 GGAGACTGAGGAGACCCTGGAGG + Intronic
942042373 2:172079284-172079306 AGTGAGTGCGTAGCTCCTGGTGG + Intronic
944374076 2:199020082-199020104 GGTGAAAGTCTAGCCCCTAGTGG - Intergenic
944874557 2:203949000-203949022 GTGGAATGAGAAGCACCTGGAGG + Intronic
946402792 2:219477324-219477346 GGAGAATGAGTGCTCCCTGGTGG + Exonic
948948402 2:241233513-241233535 GGTGAATGAGCTACACCTGGAGG + Intronic
1171560328 20:26118892-26118914 GGTAAATGGGTAGCAGCTGGAGG - Intergenic
1174095922 20:48089405-48089427 GTTGAGTGAGTAGCCAATGGAGG - Intergenic
1174578616 20:51555251-51555273 GGGTAATCAGGAGCCCCTGGGGG - Intronic
1174600485 20:51720462-51720484 GGAGAATGAGAAGCTCCTGTCGG - Intronic
1175883287 20:62272667-62272689 GGTGGATGAATTGCTCCTGGAGG + Intronic
1176099283 20:63357639-63357661 GGTGAATCCCCAGCCCCTGGTGG + Intronic
1176713841 21:10332261-10332283 GTTGACTGGGTAGCCCCTGAGGG + Intergenic
1178101135 21:29269971-29269993 GGTCAATCAGAAGCCACTGGGGG + Intronic
1178707939 21:34889875-34889897 GGTGGATGAGAGGCCCCGGGAGG - Intronic
1180075729 21:45460526-45460548 GATGAAGGAGCAGCCCCTCGGGG - Intronic
1180480715 22:15750707-15750729 GGAGATGGAGGAGCCCCTGGGGG - Intergenic
1182445881 22:30389214-30389236 GGAGAATCAGTTGACCCTGGAGG - Intronic
1182462234 22:30491188-30491210 GGTGAATGATAAGCACCTGGAGG + Intronic
1185253349 22:49817217-49817239 GGTCAAGGAGTCACCCCTGGAGG + Intronic
952858922 3:37795960-37795982 GAGGAATGAGAAGCCACTGGAGG - Intronic
953376057 3:42429478-42429500 TGTGAAGGGGTAGCCTCTGGTGG - Intergenic
954770157 3:52959932-52959954 GCTGAATGAGTACACCCTAGGGG + Intronic
961326350 3:126111668-126111690 GGTGAGGGAGGGGCCCCTGGAGG - Intronic
961563312 3:127746402-127746424 GGTGAATGGGGACCGCCTGGGGG - Intronic
962744032 3:138384163-138384185 GGTAAATGAGAAGCCATTGGAGG + Intronic
962848177 3:139288878-139288900 GGGGAAGGAATAGCCCCTGGAGG + Intronic
963300081 3:143587643-143587665 GGTGAAAGAGCAGGCACTGGAGG + Intronic
963747596 3:149141352-149141374 GGTAAATGGGTAGCAGCTGGAGG - Exonic
964665907 3:159171770-159171792 TGTGAATGAGAATCTCCTGGAGG + Intronic
965179528 3:165384174-165384196 GCTGAGAGAGTAACCCCTGGTGG + Intergenic
967501935 3:190207567-190207589 GGAGAATGCATAGCTCCTGGGGG - Intergenic
969337672 4:6521357-6521379 GGTGAATGAGAAGATCCTGGAGG - Intronic
977021485 4:91765646-91765668 GGCAAATGAGAAGCCCCAGGTGG - Intergenic
978144972 4:105362139-105362161 GTTAAATGAGAAGCCACTGGAGG - Intergenic
978620573 4:110631975-110631997 AGTGACTGAGTGGGCCCTGGTGG + Intronic
982079932 4:151779174-151779196 GTTGAATGAATAACCACTGGGGG + Intergenic
983421367 4:167522049-167522071 GGTGAATGGGCAGCCCTTGTAGG + Intergenic
988225425 5:28406077-28406099 TTTGAATGAGTAGACACTGGAGG - Intergenic
992105129 5:73444179-73444201 TGCGAATGAGGAGCCCCAGGAGG + Intergenic
999429610 5:151514839-151514861 GGAGAATCAGTAGACCCTTGAGG - Intronic
999449326 5:151666473-151666495 TGAGAATGAGAAGCGCCTGGAGG - Exonic
1001243041 5:170084564-170084586 GGTGAGTAAGCAGCACCTGGAGG + Intergenic
1001665877 5:173433446-173433468 GGGGACTGAGGAGGCCCTGGGGG + Intergenic
1003124944 6:3348691-3348713 GTTGAATGAGCAGCCGCTAGGGG - Intronic
1005078961 6:21937661-21937683 AGTGACTGAGTAGGCCGTGGTGG - Intergenic
1006186124 6:32182632-32182654 GGTGGAGCAGTAGCTCCTGGTGG - Exonic
1010030895 6:71269552-71269574 GGAGAATGTGGAGCCCCTGGGGG - Intergenic
1010106199 6:72171082-72171104 GGTTAAGGAGCAGCCCTTGGAGG - Intronic
1010891156 6:81312518-81312540 GGTCATTGAGTAGCCACTGGAGG - Intergenic
1013579422 6:111518353-111518375 AGTGAATGAGAAGCCTCTGGAGG - Intergenic
1016636613 6:146299613-146299635 TTTGAAGGAGTAGCACCTGGAGG - Intronic
1017413819 6:154198383-154198405 GGTGAATGAGTAGCATAGGGAGG - Intronic
1020432784 7:8130591-8130613 AGTCAATGTGTAGACCCTGGAGG + Intronic
1028626179 7:92880378-92880400 GGTAAATGAGTGACCCCTAGTGG + Intergenic
1028941839 7:96530276-96530298 GGTGAAAGAGTAGCTGCTGGTGG + Intronic
1030078006 7:105753161-105753183 GCTGAAGGAGAAGCCACTGGAGG + Intronic
1033195209 7:139321643-139321665 GGAGAAGGTGTAGCCTCTGGGGG + Intergenic
1035227121 7:157439784-157439806 GGTGATGGAGGTGCCCCTGGAGG - Intergenic
1035227145 7:157439888-157439910 GGTGAAGGAGGTGCTCCTGGAGG - Intergenic
1042085188 8:65099679-65099701 GGTGACTGATTAGCACTTGGTGG + Intergenic
1042876036 8:73440762-73440784 GAGAAATGAGAAGCCCCTGGAGG - Intronic
1046801482 8:118433142-118433164 GCTGAATGAGTAGCAAATGGAGG - Intronic
1052886823 9:33657363-33657385 GGTCAATGTGTAGCCCACGGTGG + Intergenic
1055649350 9:78392200-78392222 GGCGAATGAATAGACCCAGGAGG - Intergenic
1055802698 9:80057688-80057710 GGCCAATGAGTAGCCTGTGGTGG + Intergenic
1056378345 9:86035581-86035603 GGTGAATGAGGAGCCTCAGAGGG - Exonic
1059313808 9:113407076-113407098 TGTGAATGAGCAGCACCTGCTGG + Intergenic
1061033610 9:128101517-128101539 GATGAATAAGTAACCCCTGTGGG + Intronic
1061425623 9:130496670-130496692 GGCCAAGGAGGAGCCCCTGGAGG + Intronic
1062004599 9:134232936-134232958 GGTCCTTGAGTAGCCCCTGGGGG - Intergenic
1062041550 9:134406691-134406713 GGCGAAAGTGAAGCCCCTGGAGG - Intronic
1062413466 9:136436284-136436306 GGTGACCGAGGAGCCCCTGCTGG - Intronic
1190436921 X:50434556-50434578 GGTGAAATAGTGGCCCCTGGGGG - Intronic
1192230427 X:69260922-69260944 AGTCAATGAGCAGCACCTGGTGG - Intergenic
1193406696 X:81109187-81109209 AGTGAATGAGAACTCCCTGGGGG - Intergenic
1201766637 Y:17579252-17579274 GGTGAAAGAGCAGCCTCTAGTGG + Intergenic
1201834915 Y:18326732-18326754 GGTGAAAGAGCAGCCTCTAGTGG - Intergenic