ID: 1127245769

View in Genome Browser
Species Human (GRCh38)
Location 15:57172623-57172645
Sequence CCTTGAAGGTAGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2641
Summary {0: 1, 1: 13, 2: 144, 3: 702, 4: 1781}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127245761_1127245769 -4 Left 1127245761 15:57172604-57172626 CCTGTAGACACGGGGGCCTCCTT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1127245769 15:57172623-57172645 CCTTGAAGGTAGAGGGTGGGAGG 0: 1
1: 13
2: 144
3: 702
4: 1781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127245769 Original CRISPR CCTTGAAGGTAGAGGGTGGG AGG Intronic
Too many off-targets to display for this crispr