ID: 1127245769 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:57172623-57172645 |
| Sequence | CCTTGAAGGTAGAGGGTGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2641 | |||
| Summary | {0: 1, 1: 13, 2: 144, 3: 702, 4: 1781} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127245761_1127245769 | -4 | Left | 1127245761 | 15:57172604-57172626 | CCTGTAGACACGGGGGCCTCCTT | 0: 1 1: 0 2: 0 3: 5 4: 84 |
||
| Right | 1127245769 | 15:57172623-57172645 | CCTTGAAGGTAGAGGGTGGGAGG | 0: 1 1: 13 2: 144 3: 702 4: 1781 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127245769 | Original CRISPR | CCTTGAAGGTAGAGGGTGGG AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||