ID: 1127250799

View in Genome Browser
Species Human (GRCh38)
Location 15:57235659-57235681
Sequence CAGAATCAGGAGAAGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127250799_1127250804 13 Left 1127250799 15:57235659-57235681 CCATATTCCTTCTCCTGATTCTG 0: 1
1: 0
2: 7
3: 93
4: 463
Right 1127250804 15:57235695-57235717 ACTGATATTTTACATGTAACAGG 0: 1
1: 0
2: 1
3: 28
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127250799 Original CRISPR CAGAATCAGGAGAAGGAATA TGG (reversed) Intronic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901269733 1:7942513-7942535 CAGAAGCAGAAGAAGGCAGACGG + Intronic
902176088 1:14652378-14652400 GAGAAACAGGAGGAGGAAGAAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902695542 1:18138403-18138425 CAGTAGCAGTAGTAGGAATACGG - Intronic
903416929 1:23189937-23189959 AAGAATGAGGGGCAGGAATATGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903663705 1:24994339-24994361 CAGAACCAGGAGCTGGAATCAGG - Intergenic
904149144 1:28422655-28422677 CAGATACAGGAAAAGAAATATGG - Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906677263 1:47702104-47702126 CAGAATCAAGAGAAAGGAAAGGG - Intergenic
906847390 1:49207872-49207894 AAGAATCAAGAGCAGGAATGAGG - Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
908290762 1:62664902-62664924 CAGATTCAGGAGAGGGCAAAGGG + Intronic
908474768 1:64476739-64476761 CATAATAAGCACAAGGAATAAGG - Intronic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911616623 1:100019610-100019632 CAGTTTCAGGAGATGGAATGAGG - Intronic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912809041 1:112779934-112779956 CAGAGTCAGGAGCATGACTATGG - Intergenic
913468686 1:119169523-119169545 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
914452162 1:147802301-147802323 CAGAATCTGGGGAAGCAAAAGGG - Intergenic
914855131 1:151345205-151345227 CAGAGGCAGGAGAAATAATAAGG + Intronic
914962862 1:152221644-152221666 CAGAAAGAGAAAAAGGAATATGG + Intronic
915585845 1:156843533-156843555 CAACATCAGAAGAAGGAAGAAGG + Intronic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916852130 1:168714212-168714234 CAGACTCACCAGCAGGAATATGG + Exonic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917687778 1:177435005-177435027 TAAAATGAGGAGAAGGAATTAGG - Intergenic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918061716 1:181067262-181067284 CAGAATCAGCCTAAGGAACATGG + Intergenic
919146096 1:193637158-193637180 CAAAATCAGAGAAAGGAATATGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919348388 1:196416647-196416669 ATGAATCAGGAGAAGAAATAAGG - Intronic
920391148 1:205603157-205603179 TAAAATCAGAATAAGGAATAAGG + Intronic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920871366 1:209797943-209797965 CAGAATCAGAGGAAGGGATTGGG - Intronic
921175702 1:212592524-212592546 AAAAATAAGGAGAAAGAATATGG - Intronic
921451723 1:215316354-215316376 CAGAACAAGAAGGAGGAATAGGG + Intergenic
922354349 1:224761816-224761838 CAGAATATGGACAGGGAATACGG - Intergenic
923653256 1:235893135-235893157 CAGAAGCAGAAGTAGGAATGGGG + Intergenic
923831051 1:237557743-237557765 TAGAATCAGCAGAAGGACAAAGG + Intronic
924274725 1:242374270-242374292 CAGAACCAGGAAAAGGAAAACGG + Intronic
924431708 1:244002913-244002935 CTGAATTGGGGGAAGGAATATGG + Intergenic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
1062974090 10:1670986-1671008 CAGAATCAGGAAAAGGCTTGAGG - Intronic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1067713179 10:48666523-48666545 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1068791497 10:61035396-61035418 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1071238445 10:83677095-83677117 CACAAACAGGAGGAGGAATCTGG + Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1073115879 10:101091376-101091398 CAGAATCAGGCCCAGGAAGATGG + Intronic
1073817738 10:107225724-107225746 CAGGTCCAGGAGCAGGAATAAGG + Intergenic
1074211156 10:111336439-111336461 CAGAATCTGGTGAATGAATCAGG - Intergenic
1075300499 10:121318731-121318753 CAAAATCAGGAAAATGATTAGGG - Intergenic
1077392436 11:2306410-2306432 TAGAATGAGGAGAAAGAAAATGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078155648 11:8797750-8797772 AAGAATCAGGAAAAAGAGTAGGG - Intronic
1078306564 11:10193968-10193990 CAGGATCAGGAGAAGGTCTGGGG - Exonic
1078397033 11:10990323-10990345 CAGAATCAGGACAAAGCAGATGG - Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079341674 11:19616773-19616795 AAGAACCAGGAAAAGGAAAAAGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080469462 11:32530861-32530883 CAGAATCAGGATAAAGAATTTGG + Intergenic
1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG + Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1082149322 11:48714280-48714302 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1082598508 11:55116251-55116273 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1082995201 11:59248691-59248713 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083002104 11:59301981-59302003 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083101268 11:60308682-60308704 GAAAAGCAGGAGAAGGAAAAAGG - Exonic
1083106730 11:60365466-60365488 CAGAGTCAGGGGCAGGAATGAGG - Intronic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1084441474 11:69176553-69176575 AAGAATGAGGAGGAGAAATAAGG - Intergenic
1084511955 11:69611614-69611636 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086192928 11:84101833-84101855 CAGTATCAGGAGAAAGCATTTGG - Intronic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086478416 11:87205514-87205536 CAGGATCAGAGGATGGAATAGGG + Intronic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087242225 11:95791851-95791873 CGGAATGAGAAGAAGTAATACGG + Intronic
1087872697 11:103317268-103317290 CAGAATCAGGAAAAAGTATTTGG - Intronic
1087891984 11:103545832-103545854 CACCATCAGGACAAGGAATGTGG - Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1088985902 11:114908025-114908047 CAAAATCAGGGGAAGAAAAATGG + Intergenic
1089431549 11:118429011-118429033 CAGAAGCAGGAAAAGGCATGGGG - Intronic
1091180432 11:133599569-133599591 CAAAAGCAGGAGAATGGATATGG - Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092907757 12:13117347-13117369 CAGAATTAGGGGGAGGAACAAGG + Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094123308 12:26996857-26996879 CAGGATCTGGATAAGAAATAGGG + Exonic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095139070 12:38640298-38640320 TAGAATTAGGATAAGGAAAAAGG + Intergenic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096565439 12:52473794-52473816 GAGAAGCAGGACAAGGAATCGGG + Intergenic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1097376930 12:58853527-58853549 TAGAATTCGGAGAAGGAAAAAGG - Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1099829789 12:87826740-87826762 CAGAATCAGGTAAAGCAAAAGGG + Intergenic
1100057083 12:90524866-90524888 CAGTATCATGAGAATGAAGAAGG - Intergenic
1100066516 12:90652758-90652780 AAGAAAGAGGAGCAGGAATATGG + Intergenic
1101227454 12:102704161-102704183 GAGAAGCAGGAGAAGGGAGAAGG - Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102929599 12:116852140-116852162 CAGACTTGGGAGGAGGAATAGGG - Intronic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105666014 13:22557364-22557386 CAGGAGGAGGAGAAGGAATATGG + Intergenic
1106181190 13:27371309-27371331 CACACTCAGCAGAAGGAACACGG - Intergenic
1106182288 13:27380160-27380182 CACAATCATCAGAAGGAATGTGG - Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107349808 13:39502050-39502072 CAGAATCAGAACAAGTGATAAGG - Intronic
1107587500 13:41867282-41867304 GGGATTCAGGAGACGGAATAGGG - Intronic
1108877000 13:55059821-55059843 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1109564844 13:64098777-64098799 CAGAATCAGGAGCAGGACTTGGG - Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109737379 13:66504522-66504544 CAGAATCATGAGGAAGAAAATGG + Intronic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110633410 13:77736646-77736668 CAGATTCAGCAGAAGACATAAGG - Intronic
1111448642 13:88385015-88385037 TGGAATCATGAGAAGGAATGAGG + Intergenic
1111522227 13:89420754-89420776 CCCAAACAGGAGGAGGAATAGGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111806290 13:93043292-93043314 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1111959252 13:94791817-94791839 GAGAATCAGGAGGAGGAAAGAGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1115634277 14:35276321-35276343 AAGAATGAGAAGAAGGAACAGGG + Intronic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1117018161 14:51540140-51540162 CAGAATCAGGAGAAACATTGAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117809940 14:59535420-59535442 CATGAACAGGATAAGGAATAAGG - Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1119026308 14:71155648-71155670 CAGAATCAGCTGAAGGCATCAGG + Intergenic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119587010 14:75845556-75845578 GAGGAACAGGAGAAGGAAAAGGG + Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120495821 14:85233970-85233992 GAGAATCAGCAGAAGAAAAAAGG - Intergenic
1120728271 14:87971231-87971253 CAGGATCAGCAGATGGTATATGG + Intronic
1121888620 14:97568035-97568057 CAGGAACAGGACAAGGAGTAAGG - Intergenic
1121965638 14:98301814-98301836 CAGAATTAGAGGAAGAAATAAGG - Intergenic
1124241142 15:28028534-28028556 CAGAAGCATGAGCAGGAAGAGGG + Intronic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1126562740 15:50061341-50061363 CAGGCTGAGGAAAAGGAATAGGG + Intronic
1126821766 15:52511379-52511401 CTGAATCAGGAGAAGTAATGTGG - Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1128076601 15:64830522-64830544 CAGAATCAGGGTAAGGGATTTGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128198150 15:65779153-65779175 CAAATTCAAGAGAAGGAAAAAGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131071415 15:89468679-89468701 CAAAATCAGGCTAAGGGATAAGG + Intergenic
1131420505 15:92300950-92300972 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1135177366 16:20242549-20242571 AAGAAAGAGGAGAATGAATATGG + Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135533773 16:23276906-23276928 GAGAAACAGGAGAAAGAACAAGG + Intergenic
1136076604 16:27821529-27821551 CAGAAACAGAAAAAGAAATATGG - Intronic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138673310 16:58632556-58632578 CAGAACAAGGATGAGGAATAAGG + Intergenic
1138904089 16:61309509-61309531 CAGATTCAAGACAAGGAGTATGG - Intergenic
1140790051 16:78383000-78383022 CAGGAGCAGGAGGACGAATAGGG + Intronic
1140946823 16:79776501-79776523 AAGTATCAGGAGAAGGCAAAAGG - Intergenic
1142907952 17:3059878-3059900 CAAAATGAGGGAAAGGAATAGGG - Intergenic
1142926612 17:3244388-3244410 CAAAATGAGGGAAAGGAATAGGG + Intergenic
1144259701 17:13506216-13506238 CAAAAGCAGGAATAGGAATAAGG + Intronic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146997374 17:37333137-37333159 TAGAATTAGGAGCAGGAAAAAGG + Intronic
1147309672 17:39587850-39587872 AAGAATGAGGGGGAGGAATATGG + Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148199310 17:45739611-45739633 CAGAATCAGGACAAGGGCCAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148826920 17:50400631-50400653 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150294344 17:63999652-63999674 CAGAGTCAGGAGACAGAATGGGG + Intronic
1150590362 17:66556941-66556963 CAGCATCAGGATAGGGGATAAGG + Intronic
1151769635 17:76151709-76151731 TAGCATCATGAGGAGGAATAAGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153589990 18:6663697-6663719 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1153822182 18:8841605-8841627 CTGAAGCAGAAAAAGGAATATGG - Intergenic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1155648694 18:28113922-28113944 CAGTATCTGGAGAAAGAAAAAGG + Intronic
1155708049 18:28840298-28840320 GAGAACCCGGAGAAGGTATATGG - Intergenic
1156632947 18:38992501-38992523 CAGAATCAGGACAGCGAATATGG + Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1158083658 18:53624901-53624923 AAGAATCAGAAGAAGGCAGATGG - Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158786001 18:60712473-60712495 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160405121 18:78640010-78640032 GACAATCATGATAAGGAATAAGG + Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1161384720 19:3984916-3984938 CAGCATCAGGAGAAGGTATTTGG + Intronic
1161791777 19:6364378-6364400 CAGGTTTAGGAGATGGAATAGGG + Intronic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1162595946 19:11629370-11629392 CAGAAGCAGGAGGAGCAAGATGG + Intergenic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164033461 19:21432437-21432459 CAGAAACAGGAGAACGGATTTGG + Intronic
1164128320 19:22338558-22338580 CACAATCCCCAGAAGGAATAGGG - Intergenic
1164171159 19:22726768-22726790 CACAATCCCCAGAAGGAATAGGG + Intergenic
1164323041 19:24167813-24167835 TAGAATTAGGAGAATGAAAAAGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1166153596 19:40893627-40893649 CAGACTCAGGTGGAGGAAAAGGG - Intronic
1166165863 19:40987927-40987949 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1168105007 19:54161168-54161190 CAGACCCAGGAGAAGGACCAAGG + Exonic
1168301828 19:55409113-55409135 CAGCTTCTGAAGAAGGAATAAGG + Intergenic
1168418637 19:56185874-56185896 CAGAATCAGGTGAGGGACTGGGG + Intergenic
925337692 2:3109714-3109736 CAAAACCAGGAGAAGCAACAAGG + Intergenic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927335733 2:21922029-21922051 CAGAATCAGGACTAGGAAACAGG + Intergenic
928361088 2:30662885-30662907 CAGGTGCAGGAGGAGGAATAGGG + Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928504376 2:31934669-31934691 CAGAGTCAGGTAAGGGAATAGGG + Intronic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929015009 2:37485227-37485249 AATAAGGAGGAGAAGGAATATGG - Intergenic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
931903554 2:66819003-66819025 GAGAATCAGGACAAGAAATTAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932917998 2:75877812-75877834 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
934605314 2:95690743-95690765 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935383370 2:102476665-102476687 AAGAAGGAGGAGAAGGAAAACGG + Intronic
935598087 2:104895669-104895691 CATAAGCAGCAGCAGGAATAGGG - Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936538771 2:113333296-113333318 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936731826 2:115391031-115391053 TAAAAGCAGGAGAAGGAATATGG + Intronic
936995393 2:118409030-118409052 CAGAATTAGAAGAAGCAAAATGG - Intergenic
938598891 2:132817216-132817238 CAGAATCATCTGAAGGAATCAGG + Intronic
940159631 2:150697286-150697308 AAGAACCAGGAGAAGGTAAATGG + Intergenic
940263585 2:151812165-151812187 CAGAAGCAGCAGAAAGATTATGG - Intronic
941046775 2:160684822-160684844 GAGAATCTGGAGAATGGATAGGG + Intergenic
941345073 2:164358433-164358455 CAGAATTGGTAGAAGGAATTGGG - Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
941684208 2:168430992-168431014 CAGAATCTGGAAAATGAAGAGGG - Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942830013 2:180228499-180228521 CAGAAGCAGGCAAAGAAATATGG + Intergenic
943335325 2:186606559-186606581 CAGAAGCAAATGAAGGAATAGGG - Intronic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
945141942 2:206696200-206696222 TAGAAAGAAGAGAAGGAATAAGG + Intronic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
945324741 2:208469866-208469888 GAGCATCATGAGAAGGCATAGGG + Intronic
945547806 2:211178947-211178969 CAGAATCATAACAAGGAACATGG - Intergenic
945890133 2:215421984-215422006 CAAAAGCAGGGGAAGAAATATGG - Intronic
946507961 2:220321722-220321744 CTGACTGAGGACAAGGAATATGG + Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946823664 2:223655160-223655182 CAGAAAAGGGAGAAAGAATAGGG - Intergenic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947369828 2:229433490-229433512 CAGAATGAGGGAAAGTAATAAGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947542305 2:230987457-230987479 CAGAATCAGGAGCAGGATCAGGG + Intergenic
948166848 2:235869624-235869646 CAGAATCATGATAAACAATAAGG - Intronic
948771572 2:240253841-240253863 CAGAATTAGGAGCAAGAATTAGG + Intergenic
948819470 2:240532510-240532532 CAGAAACACAAGAAGGAGTAAGG + Intronic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1168974428 20:1953393-1953415 CAGAAAGAGGAGAATGAATGGGG - Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1171121604 20:22573265-22573287 CAGAATCTGGAAAATGAGTAGGG - Intergenic
1173227191 20:41168842-41168864 CAGAATGTGGAGAAGCAAGAGGG + Exonic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1174068732 20:47885181-47885203 CAAAATGAGGAGAGGAAATAAGG - Intergenic
1174755281 20:53152461-53152483 CAGAATCAGGGTCAGGATTAGGG - Intronic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1177161534 21:17553484-17553506 AGGAACCAGGAAAAGGAATATGG + Intronic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1179171951 21:38980042-38980064 CACAATCAGCTGAAGGAATGTGG - Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181659063 22:24327749-24327771 CAGACTCAGTAGTTGGAATATGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182118623 22:27772963-27772985 GAGAATCAGGAGAAGAATTTGGG + Intronic
1182882171 22:33743059-33743081 GAGAAGCAGGAGAGAGAATACGG - Intronic
1183101818 22:35588808-35588830 AAGGGCCAGGAGAAGGAATAGGG + Intergenic
949708489 3:6846237-6846259 CAAGATCAGGAGAAGTAAGATGG + Intronic
951777554 3:26326183-26326205 CAGTAACAGGCGAAGGAATTAGG + Intergenic
951857193 3:27210596-27210618 CAGAAGTCGCAGAAGGAATAGGG - Intronic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
952186661 3:30976941-30976963 CACAATCAGCAGAAGGAAAAGGG - Intergenic
952921892 3:38291082-38291104 TAAAATTAGGAGAAGGAAAAAGG - Intronic
953468965 3:43150503-43150525 CAAATTGAGGGGAAGGAATATGG + Intergenic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955065404 3:55529817-55529839 AAGACACAGGAGAAGTAATATGG + Intronic
955386409 3:58484643-58484665 CAGAACCAGGGAAAGGAATCTGG - Intergenic
955837287 3:63070307-63070329 CAGAATCAGGTGACAGAATCAGG + Intergenic
955991419 3:64631769-64631791 AAGAACCATGAGAAGGAATATGG - Intronic
956430133 3:69178169-69178191 CAGAAACAGGAAATGGAAAAAGG - Intronic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957122006 3:76105795-76105817 TCCAATAAGGAGAAGGAATATGG + Intronic
957641919 3:82864610-82864632 CATCACCAGGAGAATGAATAAGG + Intergenic
958833548 3:99117670-99117692 AAGAAGGAGGAGAAGGAAAAAGG + Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961334307 3:126160997-126161019 AAGGACCTGGAGAAGGAATAAGG + Exonic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963809150 3:149757695-149757717 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964352226 3:155814655-155814677 CAAAAAGAGGATAAGGAATATGG + Intergenic
964886321 3:161487398-161487420 GAATATCAGGAGAAGGAAAATGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965554123 3:170002116-170002138 CAGAATCCGGGGAAGGAGCAAGG + Intergenic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
967142798 3:186576356-186576378 CAGCATTAGGGGAAGGAATTAGG + Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
969645292 4:8424979-8425001 TAAAATTAGGAGAAGGAAAAAGG + Intronic
969990172 4:11253919-11253941 CCAAAGCAGGAGAAGGAACAGGG - Intergenic
972179176 4:36442919-36442941 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
973653330 4:53019547-53019569 CAACATCAGGAGAAGAAATAAGG + Intronic
973890177 4:55360662-55360684 CAGCATCAGGATGAAGAATATGG + Intronic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978678834 4:111353259-111353281 CACCATCAGGAGAAGGAAAATGG + Intergenic
978909890 4:114050573-114050595 TAGAATTAGGATAAGGAAAAAGG + Intergenic
979513753 4:121583345-121583367 CAGAATCAGGGAAAGGAAATCGG - Intergenic
979846081 4:125513936-125513958 CAGAACTCTGAGAAGGAATAAGG + Intergenic
980232326 4:130060942-130060964 CAGAAAGGGGAGAAGAAATAGGG - Intergenic
980359359 4:131747199-131747221 CAGAATCAGGAGACCGATCAAGG + Intergenic
980362608 4:131762072-131762094 CAGAATCAGGAGACCGATCAAGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981341585 4:143627950-143627972 CAGATTAAGCAGGAGGAATAGGG - Intronic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982871770 4:160588290-160588312 CAAATTCAGGAAAAAGAATATGG - Intergenic
983157421 4:164367552-164367574 AAAAATCAAGAAAAGGAATATGG - Intronic
983666700 4:170191450-170191472 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
983780674 4:171666456-171666478 CAGGAGCAGGAGAAAGAAAAAGG - Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985124734 4:186682156-186682178 CAGATTCAGGACTAGGAATCAGG + Intronic
985164648 4:187079596-187079618 CAAAACTAGGAGAAGAAATAAGG - Intergenic
986417917 5:7546917-7546939 CGGGCTCAGGAGAAGGAACATGG - Intronic
986461822 5:7980356-7980378 CAGACACATGAGAAGGAAAAGGG - Intergenic
986775088 5:11006887-11006909 AAGAAACAGGAGGAGGAAAATGG + Intronic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987324364 5:16799158-16799180 CCCAACCAGGAGGAGGAATATGG - Intronic
987334528 5:16887152-16887174 CAGGATAAGGGGAAGGAATGTGG - Intronic
987567092 5:19603343-19603365 GAGACTCAGGAGAGGGAAAATGG + Intronic
988456978 5:31395302-31395324 TAGAATTGGGAGAAGGAAAAAGG - Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989240854 5:39201957-39201979 CAAAGTCAGGAAAAGGAAAAGGG - Exonic
989697886 5:44225016-44225038 CAGAATCATGAGTTGGAAGAAGG - Intergenic
992315834 5:75554017-75554039 CTTAACCAGGAGATGGAATATGG - Intronic
993212217 5:84966240-84966262 CAGAAGCAGGCAAAGGACTACGG - Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003130352 6:3390140-3390162 CACAGTCAGGAAAAGGAATGAGG + Intronic
1003238856 6:4323816-4323838 CAGAATGAGTAGAAGGGATATGG - Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003571683 6:7260409-7260431 CAGAACCAGGAGATGGGACATGG - Intergenic
1003951132 6:11116803-11116825 CAGAATATGGACAAGCAATAGGG - Intronic
1005078149 6:21928774-21928796 CAGAATGAGGAGAGGTAAAATGG - Intergenic
1005323330 6:24676975-24676997 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1006113064 6:31760424-31760446 CAGAGGCAGGTGAAGGAATTTGG - Intronic
1006278766 6:33029323-33029345 CAGAATAATGAGAATTAATACGG - Intergenic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008401886 6:51072690-51072712 CAGACTCAGGAGAAAGGGTAAGG - Intergenic
1009463763 6:63945926-63945948 TAGGTTCAGGAAAAGGAATAAGG - Intronic
1009545115 6:65010716-65010738 TAAAATTAGGAGAAGGAAAAAGG + Intronic
1009619448 6:66053998-66054020 CAAAATCATTGGAAGGAATAGGG - Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010173969 6:73004840-73004862 CAGAAGCAGGGGGAGGAAAACGG + Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011189452 6:84714481-84714503 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1011539526 6:88415412-88415434 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1012857206 6:104516618-104516640 CAGAATCAAGGGAAGTAAAAAGG - Intergenic
1013395442 6:109733128-109733150 CAGTTTCCTGAGAAGGAATATGG + Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1014882492 6:126740809-126740831 CAGAATCAGCATTAGGAAAAAGG - Intergenic
1015081449 6:129230390-129230412 GAGAATAAGAAGAAAGAATATGG + Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016353489 6:143193205-143193227 CAGTATCAGGTGAGGCAATATGG - Intronic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016562508 6:145412880-145412902 CAGAATGAGGGGAAGGCATCTGG + Intergenic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1018529882 6:164751398-164751420 CAGAATCAGGGGAAGCCAGATGG + Intergenic
1018574480 6:165245004-165245026 CAGAGCCAGCAGGAGGAATAAGG + Intergenic
1018761380 6:166897005-166897027 TAGAATTGGGAGAAGGAAAAAGG + Intronic
1019108751 6:169692370-169692392 CAGAATCAGGAGTGGGTAAAAGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1021507142 7:21398252-21398274 CAAAACCAGAAGAAGGAAAAAGG + Intergenic
1021777684 7:24069652-24069674 GAGAAACAGTAGAAGCAATAGGG - Intergenic
1022415079 7:30170476-30170498 CAGAATCTGGAGACAGAATCTGG + Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023439194 7:40169141-40169163 TATAATTAGGAGAAGGAAAAAGG - Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1024253586 7:47523697-47523719 CATTATCAGGAGAAGGAACCAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1026571148 7:71532169-71532191 CAAAGTCAGGAGAAGGAAACAGG - Intronic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1027831915 7:83187653-83187675 ATGAAGCTGGAGAAGGAATAAGG + Intergenic
1028588247 7:92471887-92471909 TAGAATTAGGAGAAGAAAAAAGG - Intronic
1028866601 7:95720692-95720714 CAGAATCATGATAAGAATTATGG - Intergenic
1028873473 7:95794191-95794213 CAGAATCAGAAGAAAGGAGATGG - Intronic
1029042212 7:97588342-97588364 CAGAATCAGGGAAAGGGATGAGG - Intergenic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030955931 7:115852184-115852206 CAGAAACAGAAGAAAAAATAGGG + Intergenic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031264893 7:119569589-119569611 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1031471640 7:122174758-122174780 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1031894648 7:127335288-127335310 CAGAGGCTGGGGAAGGAATAGGG + Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032725941 7:134590205-134590227 TAGAATTAGGAGAAGAAAAAAGG + Intergenic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033485816 7:141787939-141787961 CAGAATCATGAGAATTTATAGGG - Intergenic
1033547552 7:142415333-142415355 CAGAATTGGGGGAAAGAATAAGG - Intergenic
1033831904 7:145264986-145265008 CAGAAGCAGGACAAGGAATAGGG - Intergenic
1034864782 7:154631777-154631799 CAGAATTAGAAGAAGTAATAGGG + Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1038115426 8:24548606-24548628 CAGTATCTGCAGAAAGAATAAGG - Intergenic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1038392578 8:27217627-27217649 CAGCATCAGGAGAAAGACGATGG + Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1040527421 8:48237168-48237190 TAGAATTAGGAGAATGAAAATGG - Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1043100005 8:76031968-76031990 CAAAATCAGGAAAGGCAATAAGG - Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043620288 8:82182418-82182440 CAGAAGCAGGATAAGTGATATGG + Intergenic
1043756429 8:84009530-84009552 CAGAAGCAGGGGAAGGGGTAGGG + Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044215551 8:89605462-89605484 CAGACTCAGGATCAGGAATCAGG - Intergenic
1044601685 8:94011654-94011676 CAGAATGGAGAGAAGGGATAGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045659057 8:104417498-104417520 TAGAGTCAGGAGAAGAAATCAGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1046174312 8:110555087-110555109 CAAAATCATAAGAAGGACTATGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048337980 8:133517186-133517208 CAGAATCCAGAGAAGGACTGGGG - Intronic
1048768771 8:137872323-137872345 CAGAATTTAGAGAAAGAATAAGG - Intergenic
1049060792 8:140274536-140274558 CAAAATCAGTGGAAGAAATATGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050633815 9:7588362-7588384 GAGAATCAGGTGAAAGAATAAGG + Intergenic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1051063124 9:13068692-13068714 CAGAAACAGCAGAAGGATCATGG + Intergenic
1052024517 9:23559764-23559786 CATAAGCAGGATAAAGAATATGG - Intergenic
1052528884 9:29656495-29656517 TACAATTAGGAGAAGGAAAAAGG - Intergenic
1053134529 9:35641973-35641995 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055335288 9:75227435-75227457 CAGGACCAGGAGAGAGAATAGGG + Intergenic
1055888462 9:81096141-81096163 CAGGATCTGGAGAATGAATTGGG + Intergenic
1056114601 9:83429760-83429782 CAGGACCAGGATAAAGAATAAGG - Intronic
1056334512 9:85553824-85553846 CAGAATCAGGAGTTGGATTGAGG - Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1060531331 9:124348609-124348631 CAGGATCAGCATAAGGATTAAGG + Intronic
1061263245 9:129491398-129491420 CGGAATCAGGAGAAGACAGAGGG + Intergenic
1186675458 X:11812252-11812274 CAGAAGCGGGAGAAAGAATTAGG - Intergenic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1188500784 X:30823809-30823831 TAGACTCAGGAGATGCAATAAGG - Intergenic
1188814157 X:34690620-34690642 CAAAATTAGTAGAAGTAATAAGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189573338 X:42323056-42323078 GAGAAACAGGAGAATGGATATGG - Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1190463869 X:50706494-50706516 CAGAATCAGTCAAATGAATAGGG - Intronic
1191924873 X:66298305-66298327 TAGAATTAGGAGAACGAAAAAGG - Intergenic
1192030142 X:67501992-67502014 CAGACTAAGGAGAAAGAATGAGG + Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195707787 X:107750562-107750584 CAGAAACAGGAGACAGAACAAGG + Intronic
1196108868 X:111925076-111925098 CAGATATAGGAGAAGAAATATGG + Intronic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197827414 X:130604963-130604985 GAGCAACAGGAGAAGGCATAGGG + Intergenic
1197835847 X:130692888-130692910 ATGAATCAGAAGAGGGAATACGG - Intronic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198603301 X:138308679-138308701 CAGATTGAGGGGAAGTAATATGG - Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic