ID: 1127254993

View in Genome Browser
Species Human (GRCh38)
Location 15:57282469-57282491
Sequence TTCTTCCCTTCTCTTAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127254993_1127254997 24 Left 1127254993 15:57282469-57282491 CCTGCCTTAAGAGAAGGGAAGAA 0: 1
1: 0
2: 2
3: 27
4: 319
Right 1127254997 15:57282516-57282538 GAGCCGCCAACCACACTGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 290
1127254993_1127254995 -1 Left 1127254993 15:57282469-57282491 CCTGCCTTAAGAGAAGGGAAGAA 0: 1
1: 0
2: 2
3: 27
4: 319
Right 1127254995 15:57282491-57282513 AGAAAAAGTTTCTGCCGTATCGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127254993 Original CRISPR TTCTTCCCTTCTCTTAAGGC AGG (reversed) Exonic
904793681 1:33042950-33042972 TTCTTCCATTCTCTGTAGTCTGG - Intronic
908273010 1:62438194-62438216 TTCTTCCCTTCTGTGTAGTCTGG + Intronic
910062696 1:83112799-83112821 TTTCTCCCTTCTCTTACTGCTGG + Intergenic
910180465 1:84477492-84477514 TTCTTTCCATCTCTTCATGCAGG + Intergenic
911012530 1:93296659-93296681 TCCTTCCCTTCACTTGAGACAGG - Intergenic
911016864 1:93342982-93343004 TTTTTTCCTTTTCTTGAGGCAGG + Intergenic
912173811 1:107133765-107133787 TTATTCTCTTCTCTTAAAACAGG + Intergenic
913384728 1:118247234-118247256 TTCTCCCCTCCTTTGAAGGCAGG + Intergenic
914897954 1:151693691-151693713 TTCTTCCCTTGTCTAGAGGGTGG + Exonic
915704383 1:157830001-157830023 TTCTTTCCTTCTCTGAAGCTAGG + Intergenic
915786408 1:158617742-158617764 GTCTTCCCTTCTCATCAGTCTGG - Intronic
916201757 1:162278286-162278308 TTCTTCCCTTCTGTGAAGCCAGG - Intronic
917121878 1:171652001-171652023 TTCTTACCTTCTCTGGAGCCTGG + Exonic
917591416 1:176480498-176480520 TACTTGCCTTCCCTTAAGGTGGG - Intronic
917675013 1:177310592-177310614 TTCTTCCCTTCGCCTGAGTCAGG + Intergenic
919037937 1:192340497-192340519 TACCTTCCTTCTCTTAAGGAGGG + Intronic
920696512 1:208184988-208185010 TTCTTCCCTTCTTTTAGGCATGG + Intronic
921890189 1:220345980-220346002 TTCTTCCTTTCCCTTAACCCTGG - Intergenic
922275181 1:224070990-224071012 CTCTTCTCTTCTCTTTAGACAGG + Intergenic
922348526 1:224717008-224717030 TCCTTCCCTTCTCATAACACTGG + Intronic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
924573877 1:245261588-245261610 TTCTTTCTTTCTCTCAAGACAGG + Intronic
1063721335 10:8584880-8584902 TGCTCTCCTTCTCTGAAGGCAGG + Intergenic
1064852081 10:19719531-19719553 TTCTTCCACTCTTTTCAGGCAGG - Intronic
1065348836 10:24776695-24776717 TTCTTCCCTTCTCCTACGATAGG + Intergenic
1065492998 10:26301571-26301593 TTTTTCCTTTCTCTTAATGGAGG + Exonic
1066186671 10:33016201-33016223 CTCTAGCCTTCTCTTGAGGCAGG + Intergenic
1066649777 10:37643267-37643289 TTCTTCCTTCCACTTAAGGAGGG - Intergenic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1068545682 10:58342544-58342566 TTCTTCTCTTCTCTTAAACCAGG + Intronic
1069790117 10:71014115-71014137 TTGTTTTCTTCTCTGAAGGCAGG - Intergenic
1070197068 10:74167736-74167758 ATGTTCCCTTCTCTTAAATCTGG - Intronic
1070523316 10:77273991-77274013 TACTGCCCTTCTCTTGAGCCTGG + Intronic
1070834584 10:79440300-79440322 TTCTCTCCTTCTCCTAAAGCAGG + Intronic
1071834148 10:89402878-89402900 TTCTTTGCTTCCCCTAAGGCAGG + Exonic
1071845638 10:89518541-89518563 TTATTCCCTTCTCTAGAGCCTGG + Intronic
1073159901 10:101383527-101383549 TTCTTTCCTTCTTTCCAGGCTGG + Intronic
1073378005 10:103053508-103053530 TTCTTTTCTTTTCTTAAGACAGG - Intronic
1074337661 10:112594315-112594337 TTATTTCCTTCTCCTAAAGCAGG - Intronic
1074638687 10:115352328-115352350 TTCTTCTCTTCTCCTAAGTTTGG + Intronic
1074963116 10:118465545-118465567 TTCTTTCTTTCTTTTAAGGCAGG - Intergenic
1075337630 10:121619795-121619817 TTCTTTCCTTCTTTTGAGTCTGG + Intergenic
1076054835 10:127364042-127364064 TGCTTCTCTTCTCTCAAGGCCGG + Intronic
1077223729 11:1428641-1428663 TTCTTTCCTTTTCTGGAGGCAGG + Intronic
1078730453 11:13969377-13969399 TTTTTCCCTTCTTTTGAGACAGG - Intronic
1080064477 11:27994635-27994657 TTCTTCAATTCTGTGAAGGCTGG + Intergenic
1080103077 11:28482160-28482182 GTCTTCACTTCTCTAATGGCTGG + Intergenic
1081478673 11:43462587-43462609 TCCTTCACAGCTCTTAAGGCAGG - Intronic
1082848395 11:57744309-57744331 TTATACCCTTCTCCCAAGGCAGG - Exonic
1083587068 11:63867967-63867989 TTGTTACCTTCTTTGAAGGCTGG + Intronic
1083846970 11:65341052-65341074 TCCTTCCCATCTATTAAGCCAGG + Exonic
1084287484 11:68141504-68141526 TTCTTTCTTTTTCTTAAGACAGG + Intergenic
1084843617 11:71880539-71880561 TTCTTTCCTTCTCCTAAGTTTGG + Intronic
1087273617 11:96138596-96138618 TTCTTACCCTCTCTGAATGCTGG - Intronic
1088448074 11:109953650-109953672 TTCTTCCCTGCTTCTAAGCCAGG - Intergenic
1088891558 11:114048750-114048772 TCCTTCCCTTCTCTTGATGCAGG + Intergenic
1090341445 11:126024821-126024843 TACTTCCCATCTCTAAAGGTTGG - Intronic
1092909597 12:13135135-13135157 TTATTACCTTCTATTAGGGCAGG - Intronic
1094073794 12:26450348-26450370 TTCTTCCCTTCTCTTAAAAAAGG + Intronic
1094639548 12:32260847-32260869 TGCTTCCCTTCACTTAAACCTGG + Intronic
1097674660 12:62586241-62586263 TTGTTCCCGTCTCATAAGGTAGG + Intronic
1099178950 12:79455792-79455814 TTTGTCCCTCCTCTTAGGGCTGG - Intergenic
1099790977 12:87333009-87333031 TTCTTCACTTCTCAGAAGGCAGG + Intergenic
1100575011 12:95882911-95882933 TCCTTCTCTTCTCCTCAGGCAGG + Intronic
1100737962 12:97558865-97558887 TTCTTTCCTTCTGTTACGCCTGG - Intergenic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1100837365 12:98579302-98579324 TTATTTTCTTCTCTTCAGGCAGG + Intergenic
1101711597 12:107272193-107272215 TTCTTCCCTTCTCTGTATGTTGG + Intergenic
1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG + Intronic
1102616095 12:114155641-114155663 TACCTCCCTTCTCTGAAGGCTGG - Intergenic
1103355768 12:120319019-120319041 TTCTTCCCTACTCTTCAAACTGG - Intergenic
1104700080 12:130896485-130896507 TTCTTTCCTTTTTTTGAGGCAGG + Intergenic
1105415396 13:20207532-20207554 TTCTTTCGATCTCTTACGGCTGG + Intergenic
1105444706 13:20443027-20443049 TTCTTCCCTTCAGGAAAGGCAGG - Intronic
1106571478 13:30932202-30932224 TTCTGCCCCTCTCCTAAGCCAGG + Intergenic
1106956366 13:34942792-34942814 CTCTTCCCTTCTCCTCAGGAGGG + Exonic
1107090583 13:36474745-36474767 TTCTTTTCTTCTCTTAAGTTTGG + Intergenic
1107191017 13:37586084-37586106 TTATTCCCTTCTCAGAATGCTGG + Intronic
1108006495 13:45952132-45952154 TTCTTCCCTACTCTTAGGTCTGG - Intergenic
1108113308 13:47101250-47101272 TGCTTCCCTTCTCTTCCGACAGG + Intergenic
1108850707 13:54725520-54725542 TTCTTCCCTTCTACTAAGTTTGG + Intergenic
1108906011 13:55474449-55474471 TTCTTCCCTTCTATTACTTCAGG - Intergenic
1109516666 13:63451691-63451713 TTCTTCCCTTTTATTAAGTTTGG - Intergenic
1112192168 13:97188630-97188652 TTTTTCCTTTCTCTTTTGGCTGG - Intergenic
1112775105 13:102835323-102835345 TTTTTCCCTTTTTTTGAGGCAGG - Intronic
1115279373 14:31644167-31644189 TTCTTCCCTTCTGTTAATTTTGG + Intronic
1117504184 14:56385282-56385304 TTCTTCCCTTCTACTAATGTTGG + Intergenic
1118943222 14:70358206-70358228 TTCTTCCTGCCTCTTAATGCTGG - Intronic
1119240914 14:73058865-73058887 TTCTTCTCTTCTCTAAGGCCTGG + Intronic
1120369188 14:83610305-83610327 TACTTCCCTCCTTTTAAGTCTGG - Intergenic
1120822816 14:88928714-88928736 TTCTTCCCTTCCCAGAAAGCTGG - Intergenic
1123039098 14:105483139-105483161 TCCCTCCCCTCTCTTGAGGCTGG - Intergenic
1123581913 15:21722951-21722973 TTCTTCTCTTCCCTGGAGGCAGG - Intergenic
1123618562 15:22165551-22165573 TTCTTCTCTTCCCTGGAGGCAGG - Intergenic
1125927549 15:43575495-43575517 TCCTTCCCTTCCCTTAAATCTGG + Intronic
1125940692 15:43675060-43675082 TCCTTCCCTTCCCTTAAATCTGG + Intergenic
1126111074 15:45175147-45175169 TCCTTCCATTCTCTTGAGCCTGG + Intronic
1127121795 15:55778301-55778323 TTCTTTCTTTCTCTTGAGACAGG + Intergenic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1128343622 15:66840071-66840093 TCCTTCCCTTCTTCTATGGCAGG + Intergenic
1128417273 15:67458273-67458295 TTCTTCCATTTTCTTCAGGGTGG + Intronic
1128751661 15:70154512-70154534 CTCTTCCTGTCTCTTGAGGCTGG + Intergenic
1130776105 15:86985125-86985147 TTTTTCCATTCTCTTAATGATGG + Intronic
1133391901 16:5417554-5417576 TGTTTTCCTTCTCTTAAGCCAGG - Intergenic
1133798832 16:9068285-9068307 TTCTTACCTGCTGTTAAAGCTGG - Intergenic
1134537039 16:15034513-15034535 TTCTTCCCTTCTGTAAAGCCTGG - Exonic
1134780380 16:16889912-16889934 TTCTTCTCTTCTTGTAAGGATGG + Intergenic
1135206506 16:20489299-20489321 TTTTTCACATCTCTTAAGGTTGG - Intergenic
1135212380 16:20534337-20534359 TTTTTCACATCTCTTAAGGTTGG + Intergenic
1136397017 16:29998579-29998601 TTTTCCCCTTCTTTTAATGCTGG + Intronic
1137676894 16:50308309-50308331 TTCTTCCCTCCTCTCCAGGACGG + Exonic
1140159818 16:72477409-72477431 TTCATCCCTTCTCTGATGGACGG + Intergenic
1140394794 16:74617347-74617369 TTCCTCCTTTCTCATAAGCCTGG - Intergenic
1141893054 16:86940381-86940403 TTCTTCCATTCTTTTCAGACTGG - Intergenic
1142814007 17:2411263-2411285 TCCTTCCCACCTCTTAAGGGAGG - Intronic
1145211899 17:21020031-21020053 TTCTTCCCTTCTCAAAACACTGG + Intronic
1145929731 17:28676562-28676584 ATCTTCCCTTCTCTAAGAGCTGG - Intronic
1146834140 17:36096252-36096274 TTCTTCCCTGCTTTTAATGAAGG + Intergenic
1147888065 17:43697981-43698003 TCCTTCCCTTCCCTCAAGGCTGG - Intergenic
1149051657 17:52311914-52311936 TTTTTTCCTTCTCTTCAGTCTGG - Intergenic
1150573891 17:66412883-66412905 TTCTTCCCATCTCTAATGGCTGG - Intronic
1151560537 17:74867345-74867367 TTCTCCCCATCTCTGAGGGCCGG - Intronic
1151786669 17:76278558-76278580 TGCTCCCCTTCTCCTAAGGATGG - Intronic
1154130608 18:11733997-11734019 TTCATCCCTTCTGGTGAGGCTGG - Intronic
1155059480 18:22216207-22216229 TTCTTTCCTTCAATTATGGCTGG + Intergenic
1155389207 18:25315839-25315861 TTCTTCCCTTCTTTTAACTGAGG - Intronic
1155626652 18:27842967-27842989 TTGTTCCCTTTTCTTGAGGAAGG - Intergenic
1155747934 18:29384343-29384365 TTCATCCATTCTCTTAAAGTGGG + Intergenic
1156131274 18:33977945-33977967 TTCTTTCCTTCTCTACTGGCTGG - Intronic
1156260833 18:35443892-35443914 TTTTTCACATCTCTGAAGGCTGG + Exonic
1156317016 18:35978971-35978993 TTCTTATCTTCTCTGAAGGGTGG + Exonic
1156408332 18:36804359-36804381 GTCTTCCCTGCTCTTGAGGCTGG - Intronic
1157830744 18:50854940-50854962 TTCTTCCCCTTTCTTAAGTGTGG - Intergenic
1158639751 18:59193657-59193679 TTCATCCTTTCTCTCATGGCAGG + Intergenic
1161146748 19:2683473-2683495 TTCTTACCTGCTCTTGAGGTAGG + Intronic
1161378292 19:3951088-3951110 ATCTTCCCTGCTCCTTAGGCAGG + Intergenic
1162539210 19:11283819-11283841 TTTTTCCTTTTTATTAAGGCAGG - Intergenic
1167330728 19:48854260-48854282 TTTTTTCCTTCTCTTCAGCCGGG - Exonic
925147631 2:1591689-1591711 TCGTTCCCTTCTGTTCAGGCTGG - Intergenic
925276009 2:2648980-2649002 TCCTTCCTTTTCCTTAAGGCTGG + Intergenic
928441912 2:31299304-31299326 ATCATCTCTTCTCTGAAGGCTGG - Intergenic
930705101 2:54497235-54497257 TCCTTCTCTTCTTTTAAGCCAGG - Intronic
933980897 2:87549898-87549920 TTCTTCCCTTCTCTGGGGTCTGG + Intergenic
935025003 2:99268534-99268556 TTCTCCCCTTCCCCTAAGGATGG + Intronic
935794047 2:106623516-106623538 TTCATCTCTTCTCTGCAGGCTGG - Intergenic
936312933 2:111400887-111400909 TTCTTCCCTTCTCTGGGGTCTGG - Intergenic
936717012 2:115198715-115198737 TTCTTCACTGATCTTAAGTCTGG - Intronic
937449433 2:121989617-121989639 TCCTTTCCTTCTCTGAAGACTGG + Intergenic
940189448 2:151024775-151024797 TTCTGCCATTTTCTTAATGCTGG - Intronic
940327397 2:152440074-152440096 TTCTTCCATTTAGTTAAGGCAGG - Intronic
940697634 2:156999569-156999591 TTTTCTCCTTCTTTTAAGGCAGG + Intergenic
941304897 2:163851543-163851565 TTCCTCTTTTCTTTTAAGGCAGG - Intergenic
941876352 2:170437418-170437440 TTCTGACCTTCTCCTAAAGCAGG + Intronic
942147585 2:173041916-173041938 TTCTTCCCTTCCCACAAGGGTGG - Intronic
942598232 2:177612704-177612726 TACTACCTTTCTCTTAGGGCAGG - Intergenic
943007874 2:182408745-182408767 TTCTTCCATTCTTTTAAAGGTGG + Intronic
944318850 2:198312353-198312375 TTCTTCCTGTCCCTTAAGCCGGG - Intronic
945736758 2:213610331-213610353 GTCTTCCCTTTTCTTAATGTAGG + Intronic
1170729068 20:18956485-18956507 TTCTTTTTTTCTTTTAAGGCAGG - Intergenic
1172157201 20:32835966-32835988 TTCTTCCCTTTTCTTAAATGGGG + Intronic
1172726169 20:37043662-37043684 TTCCTCTCTTTTTTTAAGGCGGG - Intronic
1173189155 20:40863072-40863094 TTCTTCCCTCCTCTGCAGCCTGG + Intergenic
1173289611 20:41702803-41702825 TTCTTCTCTTCTCTTTACCCAGG + Intergenic
1173528846 20:43753038-43753060 TTCTTTTCTTTTCTTAAGACAGG + Intergenic
1174023161 20:47548048-47548070 AGCTTCCCGTCTCTTTAGGCTGG + Intronic
1174336799 20:49868219-49868241 TTCTTACCTTCTTTTCAGACTGG + Intronic
1174572991 20:51516521-51516543 TTCTTCCCTTCTCTTTCTGATGG - Intronic
1177278877 21:18952168-18952190 TTTTTCACTTGTCTTGAGGCTGG - Intergenic
1177408643 21:20701831-20701853 TTCTTCCCTTAGCTTAGGGTGGG - Intergenic
1177911326 21:27036488-27036510 TTATTGCCTTCTCTTAATACAGG - Intergenic
1180758034 22:18176754-18176776 GTCTTCTCTTCTCTCTAGGCAGG + Exonic
1180768322 22:18360546-18360568 GTCTTCTCTTCTCTCTAGGCAGG + Intergenic
1180777987 22:18501845-18501867 GTCTTCTCTTCTCTCTAGGCAGG - Intergenic
1180810711 22:18759156-18759178 GTCTTCTCTTCTCTCTAGGCAGG - Intergenic
1180826199 22:18863770-18863792 GTCTTCTCTTCTCTCTAGGCAGG + Intergenic
1181196859 22:21193411-21193433 GTCTTCTCTTCTCTCTAGGCAGG - Intergenic
1181212669 22:21299713-21299735 GTCTTCTCTTCTCTCTAGGCAGG + Intergenic
1182449456 22:30410357-30410379 CTCTTCCCATCTCATCAGGCTGG - Intronic
1183293511 22:37017184-37017206 GTCTTCCCTTTTCTAGAGGCAGG - Intronic
1183406282 22:37632190-37632212 TGCCTCCCTCCTCTCAAGGCAGG + Intronic
1184339468 22:43878309-43878331 TTCGTCCCCTCTCTCCAGGCAGG + Intergenic
1203229941 22_KI270731v1_random:101434-101456 GTCTTCTCTTCTCTCTAGGCAGG + Intergenic
1203276341 22_KI270734v1_random:89676-89698 GTCTTCTCTTCTCTCTAGGCAGG + Intergenic
951515173 3:23550961-23550983 TTCATCCCTACTAATAAGGCAGG - Intronic
951612443 3:24505851-24505873 ATCTTTCCTTCTCTTGAAGCTGG - Intergenic
953436552 3:42881801-42881823 TTATTACCTGCTCTAAAGGCAGG - Intronic
953719920 3:45346495-45346517 TACTTCCCTTCTGTTAACACAGG + Intergenic
954256044 3:49407136-49407158 CTCTTCTCTTCTCTTGAGACAGG - Intronic
955525715 3:59817775-59817797 TTCTTCCCTTTTTTTAAAGAAGG - Intronic
956742506 3:72286353-72286375 TCCTTCCATCCTGTTAAGGCTGG + Intergenic
957428416 3:80070150-80070172 TTCTTTTCTTCTTTTGAGGCAGG - Intergenic
960564975 3:119123261-119123283 TTCTTCCCTCCTCTTTACACAGG - Intronic
960962073 3:123078396-123078418 TTCTTTCCTTTTTTTTAGGCAGG + Intronic
961202155 3:125053890-125053912 CTCTTTCCTTCTCTTAGGGGCGG - Intronic
961604528 3:128083735-128083757 GTCTTCCCTTTTCTCAAGACAGG + Intronic
963693042 3:148529111-148529133 TTCTTCACTTACCCTAAGGCAGG - Intergenic
963722169 3:148874364-148874386 TTCTCCACTTCTATTAATGCAGG + Intronic
963791426 3:149586755-149586777 CTCTTCCCTTCCCTGAAGGTTGG - Intronic
963799143 3:149659014-149659036 TTCTTCCCTTAGCTAGAGGCAGG - Intronic
965914551 3:173827349-173827371 TGCTTCTGTTATCTTAAGGCTGG + Intronic
966916585 3:184587632-184587654 TTATTCCCATCTCATAAAGCAGG + Intronic
967158689 3:186716618-186716640 TGCTCCACTTCTCTCAAGGCAGG - Intergenic
967221883 3:187254371-187254393 TTCTTCCCTTCTCTTCAAATAGG - Intronic
967737852 3:192972470-192972492 TTCTTCCCTTTTTTCCAGGCAGG - Intergenic
969784716 4:9446614-9446636 TTCTTTCCTTCTCCTAAGTTTGG + Intronic
970105321 4:12576077-12576099 TTCTTCTCTTCTCTTAGTCCTGG - Intergenic
970395368 4:15660010-15660032 TTTTTCCCCTCTCTGTAGGCAGG - Intronic
970722443 4:19003552-19003574 TTCTTTCCTTTCCTTGAGGCTGG - Intergenic
970964697 4:21914560-21914582 TTTATCCCTTCTCTTCAGGCAGG + Intronic
971942497 4:33234071-33234093 TTATTCCCTTCTCTTGAGTGTGG + Intergenic
972389465 4:38601158-38601180 TTTTCCCCTTCTCTCAAAGCAGG + Intergenic
972509890 4:39758901-39758923 CTATTCCCTTTTCCTAAGGCAGG + Intronic
972902669 4:43703694-43703716 TTATTCCCTTCCCTTCAGGGTGG + Intergenic
973024217 4:45247378-45247400 TTCTACCTTTTCCTTAAGGCAGG - Intergenic
974053431 4:56962296-56962318 TTCTTCCCTTCTTTTAAATAGGG + Intergenic
975654276 4:76625736-76625758 ATCCTCCCCTCTCTAAAGGCTGG + Intronic
976286692 4:83377376-83377398 TTCTTATCTTCTCTGAAGGGTGG - Intergenic
976792237 4:88891412-88891434 TTTTTCCTTTTTCTTGAGGCAGG - Intronic
977024693 4:91802525-91802547 CTCTTCAATTCTCTGAAGGCTGG + Intergenic
977103847 4:92854344-92854366 TTTTTCCCTTCTCTGAATTCTGG + Intronic
977483360 4:97608409-97608431 TTCCTCCCTTCTCTTCACACGGG - Intronic
978516204 4:109570977-109570999 TTCTTCCCTTGACTTCAGACAGG - Intronic
979576865 4:122302857-122302879 TTCTTCAATTCTATGAAGGCTGG + Intronic
980392212 4:132161842-132161864 TTCTTCCTTTATGTAAAGGCAGG + Intergenic
982385933 4:154802440-154802462 TTTTTCCCTTCTGTTAATGTTGG + Intronic
983086039 4:163445531-163445553 TCCTTCCCTTTTTTTAAGACAGG - Intergenic
983389751 4:167114395-167114417 TTCTTCCCATTTCTTAGGACTGG + Intronic
983993532 4:174152569-174152591 TTCTTTTCTGCTCTTAATGCAGG + Intergenic
984864964 4:184273436-184273458 TTCTTTCTTTCTTTTGAGGCAGG + Intergenic
984924541 4:184795022-184795044 TTCTTCCCTTTCATTGAGGCGGG - Intronic
985891814 5:2721817-2721839 TTCTTTCTTTCTCTAGAGGCTGG - Intergenic
986082763 5:4411276-4411298 TTCTTCGCTTCTCTCATCGCTGG + Intergenic
987469040 5:18308068-18308090 TTCATGCCTTCTCTCAAAGCTGG + Intergenic
988992638 5:36686376-36686398 TTCCTCCCTTCTGATAAGACTGG + Exonic
990843747 5:60113243-60113265 TTCTTCTATTTTCTTAAGGAAGG - Intronic
992129462 5:73676599-73676621 TTCTTCCATTTTCTCAAGGAGGG + Intronic
992670491 5:79055904-79055926 TTCCTCTCTGCTTTTAAGGCAGG - Exonic
993407210 5:87526321-87526343 TACTTCCCTTCTCCTAAGGAAGG + Intergenic
993730168 5:91412854-91412876 GTCTTCCCTGCTGTTGAGGCTGG + Intergenic
994938064 5:106282348-106282370 TTATTCCCTTTACTTAAGGAAGG + Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
996814940 5:127564275-127564297 CTCTTCCCTTCTCGTAAATCTGG + Intergenic
997488902 5:134256088-134256110 CTCTGCCCTTCTCTCCAGGCTGG + Intergenic
997749091 5:136327452-136327474 TTCTTGCCCTCTCTAAAGACTGG - Intronic
1000197919 5:158977847-158977869 CTCCTCCCTCCTCCTAAGGCAGG - Intronic
1001026883 5:168232058-168232080 TTCTTTCCTTTTCTTGAGACAGG - Intronic
1001645360 5:173277611-173277633 TTATTCCCTTATCTTGAGACTGG + Intergenic
1001669721 5:173463644-173463666 GTCTTCCCATCTCCTGAGGCTGG - Intergenic
1002349265 5:178571422-178571444 TTCTTCCCTACTAGCAAGGCAGG - Intronic
1003215700 6:4108512-4108534 TTCTTCCCTTTTCTTAACTTTGG + Intronic
1003340630 6:5217145-5217167 TTCTTCCTTTCTTTTAAGACAGG - Intronic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1003771361 6:9305973-9305995 TGCCCCCCTTGTCTTAAGGCTGG + Intergenic
1003822191 6:9911029-9911051 CTCTCCCCTGCTCTGAAGGCAGG - Intronic
1005443028 6:25891881-25891903 TTCTTCCCCTCTCTTGAGGAAGG - Intergenic
1007585196 6:42984937-42984959 TTCTTCCCTTCTCTTACCCCCGG + Intronic
1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG + Intergenic
1009738026 6:67704339-67704361 ATCTTACCTTCCCTTAAGGAAGG - Intergenic
1010039547 6:71365039-71365061 TTTTTCTCTTCTCCTTAGGCAGG + Intergenic
1010341863 6:74763008-74763030 TCCTTCTTTTCTCTTAATGCAGG - Intergenic
1011654227 6:89535198-89535220 TTCTCCCCCTCTCCTAAGTCAGG - Intronic
1012382548 6:98637735-98637757 TTCTTCCCTTCTCCTAAGCTGGG - Intergenic
1012691799 6:102322907-102322929 TTATTTTCTTCTCTTTAGGCAGG + Intergenic
1013278813 6:108614849-108614871 TTCTTGCCTTCTCTTGAGTTAGG + Intronic
1013930961 6:115532383-115532405 TTCTAGCTTTCTCTGAAGGCAGG - Intergenic
1014213923 6:118735213-118735235 TCCTTCCCTCCACTTAAAGCAGG - Intergenic
1014964744 6:127733606-127733628 TTCTTTCTTTCTCGTAAAGCTGG - Intronic
1015069516 6:129074507-129074529 TGCTTCCCTTTACTTAAGTCTGG + Intronic
1015451209 6:133368289-133368311 TTCTTCCCTAATCTTAAAGCGGG - Intronic
1015974853 6:138779371-138779393 ATCTTCCCTTCTCTTTAGACGGG + Intronic
1016041520 6:139436660-139436682 TTCTTCCCTTTGCAAAAGGCAGG - Intergenic
1017015262 6:150094705-150094727 CTCTACCCTTCCCTGAAGGCCGG - Intergenic
1017128407 6:151087373-151087395 TTCTTTCCTTCTCTGATGGATGG - Intronic
1018002017 6:159587728-159587750 CTCTTCCCTTCTTCTAAGGGAGG - Intergenic
1018578992 6:165291192-165291214 TTGTTCACTTCTCTTCATGCTGG - Intronic
1018619832 6:165719367-165719389 TTCTTCCCTTTTCTTCCTGCTGG - Intronic
1019616224 7:1963809-1963831 TGCTTCGCTCCTCTTGAGGCAGG + Intronic
1019821095 7:3243295-3243317 TTCTTCCCTGTTCTGAAGGAGGG + Intergenic
1020211849 7:6163716-6163738 TTCTTCCCTCCTCGTAGGGAGGG + Exonic
1021033685 7:15770145-15770167 TTCAACTCTTCTTTTAAGGCAGG - Intergenic
1022633448 7:32108306-32108328 TTATTCCCTTCTCTCAATGAAGG - Intronic
1023470739 7:40515475-40515497 TTCTTCCCTCCCCTTATCGCTGG + Intronic
1023685842 7:42734557-42734579 TTCTTCCATTCTCTTAACACAGG + Intergenic
1024247911 7:47484440-47484462 TTCCTCCCTTATACTAAGGCAGG + Intronic
1024468895 7:49745961-49745983 TTCTTCCCTACTTTTTAGGTGGG - Intergenic
1027867921 7:83672332-83672354 TGCTTCCTTTTTCCTAAGGCTGG + Intergenic
1028307917 7:89289950-89289972 TTCTTCCTTTCACTTGAGGAAGG + Intronic
1029425351 7:100490870-100490892 TTTTTCCCTTCTGATGAGGCAGG + Intronic
1029610137 7:101622383-101622405 TTGCTCCCTTCTCATGAGGCTGG - Intronic
1029696078 7:102214163-102214185 TGGTTCCCTTCTCTTACGGATGG + Intronic
1029730458 7:102434718-102434740 TTCTTCCATTCTCCTGTGGCTGG + Intronic
1029872659 7:103711540-103711562 TTCTTTTCTTCTCTTAAGGCAGG + Intronic
1030356043 7:108543419-108543441 TTCTTCCCTTCTCTTGAATCCGG - Intronic
1031043123 7:116859765-116859787 TTCTTTCTTCCTCTTAAGTCTGG - Intronic
1032987528 7:137355077-137355099 GTCTTCTCTCCTCTTAAGACTGG + Intergenic
1034299429 7:150002191-150002213 TTCTTACCTTCTCTGAGGGAAGG - Intergenic
1034806576 7:154094582-154094604 TTCTTACCTTCTCTGAGGGAAGG + Intronic
1036006399 8:4669146-4669168 TTCTTCGCTTCCTTTAGGGCTGG + Intronic
1036834320 8:12047519-12047541 TTCTTTCCTTCTCCTAAGTTTGG - Intergenic
1036856165 8:12294083-12294105 TTCTTTCCTTCTCCTAAGTTTGG - Intergenic
1037352645 8:17977885-17977907 CTCTCACCTTCTCTTAAGGCTGG - Intronic
1038129869 8:24717903-24717925 TTCAGCCCTTCTCTTAGGGTAGG - Intergenic
1038186990 8:25284174-25284196 TTCTTTTCTTCTCTTAAGTGGGG + Intronic
1042768345 8:72352197-72352219 CTCTCCCCTTCCCTTAAGGATGG + Intergenic
1042806709 8:72778356-72778378 TTCTTCCCCTCCCTCAAGGAAGG - Intronic
1043467832 8:80530382-80530404 TTCTTCCCTACATTTGAGGCAGG + Intergenic
1043846111 8:85165903-85165925 TTCTTTTCTTTTCTTAAGACAGG + Intergenic
1044144630 8:88696451-88696473 TACTTCCCTTGGGTTAAGGCAGG + Intergenic
1044569853 8:93705370-93705392 TTCTTTCCTTTTCTCAAAGCAGG - Intronic
1046471019 8:114674261-114674283 CTCTATTCTTCTCTTAAGGCAGG - Intergenic
1046590823 8:116204226-116204248 TTCTTCCCTCCTCGTAGAGCAGG - Intergenic
1046746486 8:117881759-117881781 TTCTTCCCTCTTCTGAAGGTTGG + Intronic
1046782831 8:118233660-118233682 CTCTTCCTTTCCCTAAAGGCTGG + Intronic
1046847223 8:118931215-118931237 GTCTTTCCTTCTCTTTGGGCTGG + Intronic
1047515666 8:125552672-125552694 GTCTTCCCTTCCCATCAGGCTGG - Intergenic
1048412676 8:134191765-134191787 TTTTTTCCTTCTCTTAATCCAGG + Intergenic
1049084036 8:140464127-140464149 CTCCTCTCTTCTCTCAAGGCTGG - Intergenic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1051485850 9:17607011-17607033 TTCTCCTCTTCTCATAAGGCCGG + Intronic
1052108874 9:24554494-24554516 TTCTTCCCTTTTTTTAAGGGAGG + Intergenic
1052186647 9:25604973-25604995 TTCTTCAGTTCTCTTAAGCTAGG - Intergenic
1052407971 9:28086546-28086568 TTCTTCCCCTTTCATTAGGCAGG - Intronic
1052933007 9:34071194-34071216 TTTTTCCCTACTCTTAACTCTGG + Intergenic
1053419852 9:37970424-37970446 TCCTTCCCATCTCATCAGGCTGG - Intronic
1055124119 9:72699442-72699464 TTCTTTCTTTCTCTTGAGACAGG + Intronic
1056700131 9:88897006-88897028 TTCTTCCCTTGTCTTATGAATGG - Intergenic
1057445550 9:95111976-95111998 TTCTCCCCATCTCAGAAGGCAGG - Intronic
1058111835 9:101039157-101039179 TCCTTCCCTGCTCTGAAAGCAGG + Intronic
1058356781 9:104093065-104093087 TTCTTCACATTTCTGAAGGCTGG - Intergenic
1059374395 9:113871011-113871033 CACGTCCCTTCTCTCAAGGCTGG + Intergenic
1059607537 9:115850542-115850564 CTCTTCCCTTCTTTAAAAGCAGG + Intergenic
1059837454 9:118171704-118171726 TTCTTCCTTTCTTTTGAGACAGG + Intergenic
1060535022 9:124378978-124379000 TTCTTCTCTATTGTTAAGGCTGG - Intronic
1060868797 9:127022538-127022560 TCTTTACCTTCCCTTAAGGCTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062171447 9:135137121-135137143 TTCCTCCCTCTCCTTAAGGCCGG - Intergenic
1185811077 X:3111062-3111084 TTCTTCCGTCTTCTCAAGGCTGG - Intronic
1187347661 X:18481358-18481380 TTCTTTCTTTCTTTTGAGGCAGG + Intronic
1188931980 X:36123354-36123376 TTATTCCCTTCTTTTCAGGGTGG + Intronic
1192268520 X:69556767-69556789 TTCTTCCCTTCTCTGAATGCCGG - Intergenic
1192430946 X:71111218-71111240 TTCTTTCTTTCTTTTGAGGCAGG - Intronic
1193277560 X:79606819-79606841 TTCATGACTTCTTTTAAGGCAGG - Intergenic
1195399822 X:104449180-104449202 TTCTTCCCTTCCATTCAGGTAGG - Intergenic
1197919533 X:131577424-131577446 TTCTTCCCTTCTTTTCATACTGG - Intergenic
1199393810 X:147310828-147310850 TTCTTTTCTTCTCTTAACGTTGG - Intergenic
1199527793 X:148811517-148811539 TTATTACCTTCTGTTAAGGAAGG - Intronic
1199662386 X:150065031-150065053 TTTTGCCCTTCTCGTAAGGAGGG - Intergenic
1200286734 X:154830072-154830094 TTCTCCTCTGCTCTTAGGGCTGG - Intronic
1201378689 Y:13348826-13348848 CACTTCCCTTCTCTTAACCCTGG - Intronic