ID: 1127256478

View in Genome Browser
Species Human (GRCh38)
Location 15:57297826-57297848
Sequence GGCCCCCAGTCAGCCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127256478_1127256487 3 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256487 15:57297852-57297874 ATGCAGGGAAGGCTGCCTGGAGG 0: 1
1: 4
2: 32
3: 248
4: 1112
1127256478_1127256484 -8 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256484 15:57297841-57297863 TGGGGGCCAGGATGCAGGGAAGG 0: 1
1: 0
2: 16
3: 95
4: 827
1127256478_1127256486 0 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256486 15:57297849-57297871 AGGATGCAGGGAAGGCTGCCTGG 0: 1
1: 0
2: 8
3: 106
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127256478 Original CRISPR GGCCCCCAGTCAGCCCGGGC AGG (reversed) Intronic