ID: 1127256484

View in Genome Browser
Species Human (GRCh38)
Location 15:57297841-57297863
Sequence TGGGGGCCAGGATGCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 939
Summary {0: 1, 1: 0, 2: 16, 3: 95, 4: 827}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127256478_1127256484 -8 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256484 15:57297841-57297863 TGGGGGCCAGGATGCAGGGAAGG 0: 1
1: 0
2: 16
3: 95
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127256484 Original CRISPR TGGGGGCCAGGATGCAGGGA AGG Intronic