ID: 1127256486

View in Genome Browser
Species Human (GRCh38)
Location 15:57297849-57297871
Sequence AGGATGCAGGGAAGGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 881
Summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 766}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127256478_1127256486 0 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256486 15:57297849-57297871 AGGATGCAGGGAAGGCTGCCTGG 0: 1
1: 0
2: 8
3: 106
4: 766
1127256481_1127256486 -5 Left 1127256481 15:57297831-57297853 CCGGGCTGACTGGGGGCCAGGAT 0: 1
1: 0
2: 0
3: 24
4: 260
Right 1127256486 15:57297849-57297871 AGGATGCAGGGAAGGCTGCCTGG 0: 1
1: 0
2: 8
3: 106
4: 766
1127256480_1127256486 -4 Left 1127256480 15:57297830-57297852 CCCGGGCTGACTGGGGGCCAGGA 0: 1
1: 1
2: 2
3: 54
4: 477
Right 1127256486 15:57297849-57297871 AGGATGCAGGGAAGGCTGCCTGG 0: 1
1: 0
2: 8
3: 106
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127256486 Original CRISPR AGGATGCAGGGAAGGCTGCC TGG Intronic