ID: 1127256487

View in Genome Browser
Species Human (GRCh38)
Location 15:57297852-57297874
Sequence ATGCAGGGAAGGCTGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1397
Summary {0: 1, 1: 4, 2: 32, 3: 248, 4: 1112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127256481_1127256487 -2 Left 1127256481 15:57297831-57297853 CCGGGCTGACTGGGGGCCAGGAT 0: 1
1: 0
2: 0
3: 24
4: 260
Right 1127256487 15:57297852-57297874 ATGCAGGGAAGGCTGCCTGGAGG 0: 1
1: 4
2: 32
3: 248
4: 1112
1127256480_1127256487 -1 Left 1127256480 15:57297830-57297852 CCCGGGCTGACTGGGGGCCAGGA 0: 1
1: 1
2: 2
3: 54
4: 477
Right 1127256487 15:57297852-57297874 ATGCAGGGAAGGCTGCCTGGAGG 0: 1
1: 4
2: 32
3: 248
4: 1112
1127256478_1127256487 3 Left 1127256478 15:57297826-57297848 CCTGCCCGGGCTGACTGGGGGCC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1127256487 15:57297852-57297874 ATGCAGGGAAGGCTGCCTGGAGG 0: 1
1: 4
2: 32
3: 248
4: 1112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127256487 Original CRISPR ATGCAGGGAAGGCTGCCTGG AGG Intronic