ID: 1127266008

View in Genome Browser
Species Human (GRCh38)
Location 15:57362328-57362350
Sequence GTGGTTAAACCCATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127266008_1127266016 21 Left 1127266008 15:57362328-57362350 CCTTGCACCATGGGTTTAACCAC No data
Right 1127266016 15:57362372-57362394 ATTGGATGAGATGATGCATGTGG No data
1127266008_1127266014 3 Left 1127266008 15:57362328-57362350 CCTTGCACCATGGGTTTAACCAC No data
Right 1127266014 15:57362354-57362376 GCCTGGGCTACTGTGCGGATTGG No data
1127266008_1127266013 -2 Left 1127266008 15:57362328-57362350 CCTTGCACCATGGGTTTAACCAC No data
Right 1127266013 15:57362349-57362371 ACATTGCCTGGGCTACTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127266008 Original CRISPR GTGGTTAAACCCATGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr