ID: 1127267599

View in Genome Browser
Species Human (GRCh38)
Location 15:57374393-57374415
Sequence ACAATTTCATTCTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127267598_1127267599 15 Left 1127267598 15:57374355-57374377 CCTTTCTCTCTTTCTTTTCTTTT No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data
1127267596_1127267599 23 Left 1127267596 15:57374347-57374369 CCCTCTCTCCTTTCTCTCTTTCT No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data
1127267597_1127267599 22 Left 1127267597 15:57374348-57374370 CCTCTCTCCTTTCTCTCTTTCTT No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data
1127267595_1127267599 26 Left 1127267595 15:57374344-57374366 CCTCCCTCTCTCCTTTCTCTCTT No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data
1127267593_1127267599 30 Left 1127267593 15:57374340-57374362 CCTCCCTCCCTCTCTCCTTTCTC No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data
1127267594_1127267599 27 Left 1127267594 15:57374343-57374365 CCCTCCCTCTCTCCTTTCTCTCT No data
Right 1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127267599 Original CRISPR ACAATTTCATTCTGTTGCCC AGG Intergenic
No off target data available for this crispr