ID: 1127270088

View in Genome Browser
Species Human (GRCh38)
Location 15:57392686-57392708
Sequence CTGGATAATAAAGCTGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127270081_1127270088 24 Left 1127270081 15:57392639-57392661 CCTTCTGTTCATCATCTGTCTCC 0: 1
1: 1
2: 2
3: 33
4: 482
Right 1127270088 15:57392686-57392708 CTGGATAATAAAGCTGTATAAGG 0: 1
1: 1
2: 1
3: 8
4: 161
1127270083_1127270088 3 Left 1127270083 15:57392660-57392682 CCTACTGAAGGCTATTGTCCCAG 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1127270088 15:57392686-57392708 CTGGATAATAAAGCTGTATAAGG 0: 1
1: 1
2: 1
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127270088 Original CRISPR CTGGATAATAAAGCTGTATA AGG Intronic
907529814 1:55083683-55083705 CTGGATAGTAAAGTTCTATATGG - Intronic
909088567 1:71197071-71197093 ATGGATAAAAAAGCTGCAGATGG - Intergenic
909218445 1:72922397-72922419 CTGTAAAAAAAATCTGTATATGG + Intergenic
909490598 1:76221888-76221910 CTGGATAATAAAGTTTTGCAGGG - Intronic
911659277 1:100482037-100482059 CTGAATATTAAAGATGAATAAGG - Intronic
911850930 1:102819477-102819499 CTGGAGAATAAACCTTTCTAAGG - Intergenic
918241801 1:182626865-182626887 CTGGAAAATAAAACTGTAGATGG - Intergenic
918630997 1:186718417-186718439 TTGAATAGTAAAGCTGAATAAGG + Intergenic
918947349 1:191084429-191084451 CTTCATAATAAAGATGTAAATGG - Intergenic
921003963 1:211074548-211074570 ATGGATTATAAAAATGTATATGG + Intronic
923735127 1:236599599-236599621 CTTGATTATAGAGATGTATATGG + Exonic
924212668 1:241786930-241786952 CAGGATAATAAAACTGCATTTGG - Intronic
1063813603 10:9744342-9744364 CTAGATAAAAAACCTGTACATGG - Intergenic
1064502689 10:15991544-15991566 ATGAATAATAAAGCTAAATATGG - Intergenic
1069864635 10:71494402-71494424 CTGGATAAGAACATTGTATATGG + Intronic
1070618581 10:77988644-77988666 ATGAAAAATAAAGCTGTAGAGGG + Intronic
1073868622 10:107834458-107834480 CTGGAAAATAATGTTGTACAAGG + Intergenic
1075957999 10:126541449-126541471 CTGGATATTAAACCTTTATTTGG - Intronic
1078792558 11:14559190-14559212 CTGAATTATAAAGCTGTAAATGG - Intronic
1080730270 11:34943914-34943936 CTGGAAAATACAGCAGGATAAGG - Intronic
1081464409 11:43303142-43303164 CTGGATAATAAAACTTGATCAGG - Intergenic
1082185769 11:49179127-49179149 CTGGATTTTAAAGATGAATAAGG + Intronic
1086313504 11:85563669-85563691 CTGGATAATATTCCTTTATATGG + Intronic
1086680555 11:89666248-89666270 CTGGATTTTAAAGATGAATAAGG - Intergenic
1087140337 11:94759509-94759531 CTGGAAAATGAAGCTGCATTTGG - Intronic
1089788443 11:120924816-120924838 CTGGGTGATAAAGGTGTATTTGG - Intronic
1093061919 12:14616380-14616402 CTGGATACAAAACCTGGATATGG + Intronic
1095988561 12:48017378-48017400 CTGGCTAACAAAGCTTTCTAAGG - Intergenic
1100480011 12:94968966-94968988 CTGGATAATAATGCTCCACAAGG + Intronic
1100946305 12:99787875-99787897 GTGGACAATAAAGCTGTGTGGGG + Intronic
1101790259 12:107919535-107919557 CTGGATGCTAAAGTTATATATGG - Intergenic
1108081550 13:46742275-46742297 CTGGGCAATTGAGCTGTATAGGG + Exonic
1108127095 13:47256344-47256366 CAGGACAATAAGGGTGTATAGGG + Intergenic
1110025027 13:70526264-70526286 CTGGATAATAAATCTGTATAGGG - Intergenic
1110219238 13:73055750-73055772 ATGAAAAATAAAGCTTTATACGG - Intronic
1117435110 14:55708494-55708516 CTGGAAACCAAAGCTGTATGGGG + Intergenic
1119803523 14:77466437-77466459 TCAGATAATAAAGCTGAATACGG - Intronic
1119938606 14:78616596-78616618 CTGGTGAACAAAGCTGCATAGGG - Intronic
1120366811 14:83581764-83581786 CTGGGAAATAAGGCTGTATGGGG - Intergenic
1121648518 14:95537566-95537588 TTGGTAAATAAAGCTGTATAGGG - Intronic
1123437116 15:20262666-20262688 CTGCATAAGAAAACTGTAGAAGG - Intergenic
1123958026 15:25360991-25361013 CTGAATACTAAAGCAGTTTATGG + Intronic
1124071584 15:26398387-26398409 CTGAATAATAATTCAGTATATGG + Intergenic
1127270088 15:57392686-57392708 CTGGATAATAAAGCTGTATAAGG + Intronic
1129335383 15:74849213-74849235 CTTAATAATAAAACTGTATGAGG + Intronic
1130752538 15:86727496-86727518 CTGGATAAAAGAAATGTATAGGG + Intronic
1130890125 15:88126715-88126737 CTGGATAAGAATGTTATATAAGG - Intronic
1131494271 15:92891402-92891424 CTTGATAATAAAAATGTATCCGG - Intronic
1134919531 16:18103017-18103039 CTGGAGAATAATGGTATATAGGG - Intergenic
1136847452 16:33588166-33588188 CTGCATAAGAAAACTGTAGAAGG + Intergenic
1203109160 16_KI270728v1_random:1436821-1436843 CTGCATAAGAAAACTGTAGAAGG + Intergenic
1144674453 17:17153010-17153032 CTGGAGAAAACAGCTGTATGTGG + Intronic
1148405098 17:47405926-47405948 CTGGGTAATAAACATGTTTAAGG + Intronic
1149884927 17:60330335-60330357 ATGGATAATAAAGTAGAATAAGG - Intronic
1153855581 18:9142569-9142591 CTAATTATTAAAGCTGTATAAGG - Intronic
1155147235 18:23094269-23094291 CTGGATACTCAAGCTGCACATGG - Intergenic
1156719370 18:40050689-40050711 CTGGATAAGAAAGTTTCATAGGG - Intergenic
1157722418 18:49935587-49935609 GTGGATAATGAAGCTGTAGTAGG + Intronic
1158206442 18:54998594-54998616 CTGTACAATAAAGCTGGAGATGG - Intergenic
1160055604 18:75476941-75476963 CTGGGTAATAAAGGTGTAACAGG - Intergenic
1161225202 19:3141339-3141361 CAGGAAAATAAAGCTGTGAAAGG + Intronic
1164864672 19:31594587-31594609 CTGGTTAATAAGGATGTTTACGG + Intergenic
1165033100 19:33012480-33012502 CTGCATAAGAAAACTGTAGAAGG - Intronic
1166595221 19:44041848-44041870 CTGGTAAATAAATGTGTATAGGG + Intergenic
927064385 2:19456666-19456688 TTTGATAATTAAGCTATATAGGG - Intergenic
927726700 2:25430181-25430203 ATGGATAAGAAATCTGTGTAGGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929654162 2:43713453-43713475 CTGCATAGTAAAGCATTATATGG - Intronic
933207460 2:79523564-79523586 GTAGACAATAAACCTGTATAAGG - Intronic
934875808 2:97918815-97918837 CTGCATAATAAAGCAGTCTAAGG + Intronic
934951571 2:98579388-98579410 TTGAATATTTAAGCTGTATATGG + Intronic
935462796 2:103358528-103358550 CTGAAGAATAAAGCTGAAAAGGG - Intergenic
935880152 2:107557328-107557350 GTGGATGATACAGCTGTACAGGG - Intergenic
937151107 2:119686377-119686399 CTTTAAAATAAAGCTGTATTAGG - Intronic
938708810 2:133957533-133957555 CTGGATTATAAAGATCAATAGGG - Intergenic
939795211 2:146634560-146634582 CTGGATAATAAAGTGATGTAAGG - Intergenic
941475450 2:165946535-165946557 CTTGGTAAAAAAGCTGTATATGG + Intronic
942358508 2:175145953-175145975 CTTAGTAATTAAGCTGTATAGGG - Intronic
942597909 2:177609594-177609616 CTGAATAATAAACCAATATAGGG + Intergenic
944640879 2:201724316-201724338 ATGGATAAGAAAGCAGGATATGG - Exonic
944837066 2:203590278-203590300 CAGGATAATCAAGATGCATATGG - Intergenic
944979595 2:205101088-205101110 TTGGATAAGAAATTTGTATATGG + Intronic
945073248 2:206012193-206012215 CTGGAAAATACAGAAGTATAGGG + Intronic
947458415 2:230280033-230280055 CTTGATAAAAAAGATATATATGG - Intronic
1169487901 20:6048710-6048732 CTGGATAGTAAAGATCTATGAGG - Intronic
1169778078 20:9277763-9277785 CTAGATAGGAAAGCTGTCTATGG - Intronic
1170925012 20:20714440-20714462 CTGGAGATAAAAGATGTATAAGG + Intergenic
1177623276 21:23624851-23624873 CTGGATAATATATATCTATATGG + Intergenic
1178003029 21:28184962-28184984 CTGGAAAATAATTCTGCATAGGG + Intergenic
1181888475 22:26040540-26040562 GAGGAAAATAAAGCTGTAGAAGG + Intergenic
1182941145 22:34278570-34278592 TTGGGTAATAATGCTGTATTAGG + Intergenic
950213071 3:11137985-11138007 CTGGATAGTACACCTGTATCAGG - Intronic
950831888 3:15882974-15882996 ATGGATAATAAAGCTGTATGAGG + Intergenic
954905450 3:54058749-54058771 CTGCATCACAAAGCTGTATGGGG + Intergenic
956492291 3:69785954-69785976 CTGGGTAATAATGCCATATAGGG + Intronic
957744625 3:84323792-84323814 CAGCGTAATAGAGCTGTATACGG - Intergenic
959219354 3:103496542-103496564 ATGTATAATGAAGCTGTCTATGG - Intergenic
959672616 3:108996319-108996341 CTGGACAATTCAGCTTTATAGGG + Intronic
960132273 3:114069889-114069911 CTAGATATTAAAAATGTATAGGG + Intronic
960249593 3:115437469-115437491 CTGGAGAATAGAACTGTAAAAGG - Intergenic
960392021 3:117089199-117089221 CTGAACAATAAAGGTGTATTGGG + Intronic
962737455 3:138338640-138338662 CTGGGAAATAAAGCTGAAAAGGG - Intergenic
965291844 3:166891117-166891139 TTGGTTAATAAATTTGTATATGG + Intergenic
965723545 3:171688397-171688419 ATGGAAAACAAAGCTGAATATGG + Intronic
966677431 3:182604492-182604514 TAGGATATTAAAGGTGTATAGGG - Intergenic
966913503 3:184572261-184572283 GGGGATAATAAAGATGTGTAAGG - Intronic
970234809 4:13947794-13947816 CTGGATAAATAAGCTGAACATGG - Intergenic
971992552 4:33918506-33918528 CTGAATTTTAAAGATGTATACGG + Intergenic
974926546 4:68305847-68305869 GTGGTTAATAAAATTGTATAAGG - Intergenic
974971362 4:68832606-68832628 CAGTATCATAAAGCTGTATTAGG - Intergenic
976295685 4:83469077-83469099 CTGGGTTATAAAACTGTATCAGG - Exonic
976903650 4:90209169-90209191 CTGTATAAAGAAGCTGTAAAGGG + Intronic
978347397 4:107786463-107786485 CTGGAAAATGAAGCTGGAAACGG + Intergenic
979746975 4:124228191-124228213 CTGGATATTAAAGCCAGATAGGG + Intergenic
980540304 4:134185059-134185081 CTGGATAATAATCCTTTATCAGG + Intergenic
981341659 4:143628577-143628599 CTGGTTAGTAAAGCTGTATTTGG - Intronic
981343884 4:143652964-143652986 TTGGAGAAAAAAGCTGTACAAGG + Intronic
982418743 4:155168347-155168369 ATGTCAAATAAAGCTGTATATGG + Intergenic
984219687 4:176957565-176957587 CTTGATAGTCAAGCTGTAAAGGG - Intergenic
984510473 4:180672834-180672856 CTGAATTAAAAACCTGTATAGGG - Intergenic
987784517 5:22482373-22482395 CTTGATAATAAATCTGCACAAGG - Intronic
988450543 5:31338382-31338404 ATGGATAACAAAGATGTATGCGG - Intergenic
990209760 5:53469834-53469856 GTGGATAATACACCTTTATATGG + Intergenic
990832296 5:59972644-59972666 TTGGAAAATAAGGCTGTAAATGG + Intronic
996221704 5:120940823-120940845 CTGTATATTAAAACTGTATTAGG - Intergenic
999211030 5:149888711-149888733 ATGGATAAGAAAGTTGTAGAAGG + Intronic
1003448107 6:6203904-6203926 CTGCATAATAAACATGTATTAGG + Intronic
1003675960 6:8204504-8204526 ATTGATATGAAAGCTGTATATGG - Intergenic
1004989438 6:21120291-21120313 CTGGATACTATAACTGTACAAGG + Intronic
1011128104 6:84028709-84028731 CTGAATAACAAAGCTGTAGCTGG - Intergenic
1011531574 6:88328051-88328073 CTGGACAATAAAGCTGACTGTGG - Intergenic
1020819601 7:12950112-12950134 GTAGAAAATAAAGCTTTATAAGG + Intergenic
1020950168 7:14665480-14665502 CTATATAATAAACCTGTACATGG + Intronic
1021230750 7:18084570-18084592 TTGTGTAATAAAGATGTATATGG - Intergenic
1021256022 7:18393375-18393397 CTGGATAGTAAAGGAGTAGAGGG + Intronic
1021700105 7:23310250-23310272 CTGGAAAATGAAGCTGCATTTGG + Exonic
1022215958 7:28261725-28261747 ATGGATAACAAAGGTATATATGG - Intergenic
1022894481 7:34735792-34735814 CTGGATATTTAAGTTGTTTACGG - Intronic
1024177257 7:46853274-46853296 CTGGATATTAATCCTGTATCTGG + Intergenic
1024895489 7:54256325-54256347 CTGGATACTAAACCCATATAAGG + Intergenic
1025155403 7:56601483-56601505 CTGGAAAATGAAGCTGCATTTGG - Intergenic
1031163195 7:118193915-118193937 CAGGAAAATACAGCTTTATAAGG - Intergenic
1031419471 7:121533200-121533222 CTTGATACTAAAACTATATATGG - Intergenic
1031452470 7:121938622-121938644 CTGGATCATAAAGCTGACAAAGG + Intronic
1033615933 7:143014147-143014169 CTGGAAGATAAAGCTGGATAAGG - Intergenic
1035993401 8:4517538-4517560 CTGTAGAATAAAGCAGTAAAGGG - Intronic
1036199592 8:6757036-6757058 CTGGAAAATAAGGATGAATACGG - Intronic
1036226965 8:6967340-6967362 CTGGAAAATACAGCTTCATAGGG - Intergenic
1037200816 8:16250116-16250138 CTGCATAAAAAAGCTGCACAGGG + Intronic
1037540823 8:19869043-19869065 CTGGAAATTAAAAATGTATATGG + Intergenic
1038301083 8:26349422-26349444 CTTGAGAATAAAGCTGTAATGGG + Intronic
1043654084 8:82640071-82640093 ATGGATACTAAAGCTTTATTTGG + Intergenic
1044299633 8:90568574-90568596 CTGGGTAAGAAAACTGAATAAGG - Intergenic
1045833958 8:106498283-106498305 CTAGATAATAAATCTATACATGG + Intronic
1046866629 8:119158198-119158220 CTTTATAATAAAGTTGTAAAAGG + Intergenic
1046938495 8:119908287-119908309 CTGGATAAAAAACCAGTAAATGG + Intronic
1047554287 8:125911970-125911992 CTGGAAAATAAATATTTATAAGG - Intergenic
1048385248 8:133906364-133906386 CTGGAATATGAAGCTGGATAAGG + Intergenic
1049312188 8:141939072-141939094 CTGGAATAAAAAGCTGTATTTGG + Intergenic
1050149025 9:2600586-2600608 CTGGATATTAAAGTCTTATAAGG - Intergenic
1050943808 9:11492826-11492848 CTGGAAAATAATGCTGAAGAAGG - Intergenic
1054917522 9:70509287-70509309 CTGGACAAAAAAGCTATATTTGG - Intergenic
1055005888 9:71505646-71505668 TTAGATGATAAAGCAGTATAAGG - Intergenic
1055105182 9:72504774-72504796 CTGGAGCATAAAGCTGAAGAGGG + Intergenic
1055891118 9:81124597-81124619 GTGGATAAGAAAGTTGTAGAAGG - Intergenic
1055910970 9:81350703-81350725 GTGGAGAATAAAGCTGTGTTGGG + Intergenic
1060320055 9:122550414-122550436 CTGGATATCAAAGCTAGATAAGG + Intergenic
1186872674 X:13787886-13787908 CTGGCTAACAAAGTTGTATCTGG + Intronic
1187336196 X:18384331-18384353 TTAGATAATAATGCTGTATTAGG + Intergenic
1190850927 X:54240886-54240908 ATGGATACTAAACCTATATATGG - Intronic
1193224631 X:78968056-78968078 TTGGATAAAGAAACTGTATATGG - Intergenic
1193444462 X:81583156-81583178 CTGGATATTAAACCTTTATCAGG - Intergenic