ID: 1127282361

View in Genome Browser
Species Human (GRCh38)
Location 15:57503227-57503249
Sequence CCTCATCAGGAGTAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127282361_1127282370 -7 Left 1127282361 15:57503227-57503249 CCTTCCTCCTACTCCTGATGAGG 0: 1
1: 1
2: 1
3: 15
4: 274
Right 1127282370 15:57503243-57503265 GATGAGGTGGCCCCAGGGATGGG 0: 1
1: 0
2: 2
3: 35
4: 383
1127282361_1127282375 22 Left 1127282361 15:57503227-57503249 CCTTCCTCCTACTCCTGATGAGG 0: 1
1: 1
2: 1
3: 15
4: 274
Right 1127282375 15:57503272-57503294 CTCTGTGACTCATACCCAAGAGG 0: 1
1: 0
2: 2
3: 11
4: 115
1127282361_1127282376 23 Left 1127282361 15:57503227-57503249 CCTTCCTCCTACTCCTGATGAGG 0: 1
1: 1
2: 1
3: 15
4: 274
Right 1127282376 15:57503273-57503295 TCTGTGACTCATACCCAAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 123
1127282361_1127282369 -8 Left 1127282361 15:57503227-57503249 CCTTCCTCCTACTCCTGATGAGG 0: 1
1: 1
2: 1
3: 15
4: 274
Right 1127282369 15:57503242-57503264 TGATGAGGTGGCCCCAGGGATGG 0: 1
1: 0
2: 1
3: 29
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127282361 Original CRISPR CCTCATCAGGAGTAGGAGGA AGG (reversed) Intronic
902651996 1:17843235-17843257 CCTCATTATGATTAGGACGAAGG - Intergenic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
904263006 1:29301175-29301197 CCTCACCCAGAGCAGGAGGAGGG + Intronic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906127467 1:43436101-43436123 GGTCATCAGGAGTAAGAGAAGGG - Intronic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
910773957 1:90856428-90856450 CCACAGCAAGATTAGGAGGAAGG - Intergenic
911657450 1:100461212-100461234 CCTCAACCTGAGGAGGAGGAAGG - Intronic
914877628 1:151524109-151524131 CCTCATCAAGATTTGAAGGAAGG + Intronic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915093596 1:153443767-153443789 CCTCTCCAGGGGAAGGAGGATGG + Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
918667639 1:187171947-187171969 GCTCACCAGGATTGGGAGGATGG - Intergenic
919943357 1:202303480-202303502 CCACATCAGGAGGAAGGGGATGG - Intronic
920039913 1:203088842-203088864 CCTCTTCAGAGGCAGGAGGATGG + Intergenic
920397882 1:205659845-205659867 CTTCCTCAGGAGTGGGAGAAGGG + Intronic
922854146 1:228759893-228759915 CTTCATAATGAGTAGGATGAAGG + Intergenic
923470305 1:234284395-234284417 CATGAGCAGGAGTAGGTGGAGGG - Intronic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924333933 1:242967952-242967974 CCTTAGCAGGGGTAGGGGGACGG - Intergenic
1063224911 10:4006552-4006574 CCTCTTCAGGAGTCTGAGGCAGG - Intergenic
1064388616 10:14921814-14921836 AGTCACCAGGAGTGGGAGGAGGG - Intronic
1065163734 10:22952330-22952352 CCATATCAGGAGTGGGAGAAGGG + Intronic
1066135210 10:32438937-32438959 CCTGAACAGGAGTAGAAGGTAGG - Intergenic
1066180710 10:32958274-32958296 CCTCCTCAGGGGCGGGAGGAGGG + Intronic
1067299818 10:44998014-44998036 CCACAGCAGGATTAGAAGGATGG - Exonic
1067681017 10:48441089-48441111 CCGCTCCAGGAGTGGGAGGAAGG + Intergenic
1069862137 10:71478398-71478420 CATCATCAGGAGGCTGAGGAAGG - Intronic
1070734695 10:78855489-78855511 TCTCATTAGGAGTGTGAGGAAGG + Intergenic
1071175550 10:82922836-82922858 ATTCATCAGGAATAGGGGGATGG - Intronic
1071480156 10:86059042-86059064 GCTCATGAGGAGGAGGAGGCAGG + Intronic
1071896158 10:90069051-90069073 ACTCATAAAGAGTAGAAGGATGG - Intergenic
1074147067 10:110726159-110726181 AGTCATCAGGAGCAGGAGGCTGG - Intronic
1075197813 10:120376248-120376270 ATTCATCAGGAGTGAGAGGAAGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075499079 10:122955166-122955188 CCTCTACAGGAGGAGGATGAGGG - Intronic
1076569057 10:131420423-131420445 CCTCAGCAGGAGGAAGAGGAGGG - Intergenic
1078245544 11:9571066-9571088 TGTCATCAGGAGTGGCAGGAGGG + Intergenic
1078276800 11:9856412-9856434 CCCCAAGAAGAGTAGGAGGAGGG + Intronic
1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG + Intronic
1079122881 11:17697644-17697666 CCTCATCAGAAAGATGAGGATGG - Intergenic
1079697420 11:23499102-23499124 CCTCAGCAGGAGTAAGCAGAGGG + Intergenic
1080332916 11:31161289-31161311 CCTCATCAGGAACAGCAGGGAGG + Intronic
1081632266 11:44697733-44697755 CCTGGTCAGGAGTGAGAGGAAGG - Intergenic
1083171904 11:60928132-60928154 CCCCATCTGGAGTTGGAGTAAGG + Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1085014115 11:73161304-73161326 GATTATCAGGGGTAGGAGGAAGG - Intergenic
1087387952 11:97497081-97497103 CCTGATTAGAAATAGGAGGAAGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1091057794 11:132435154-132435176 CCTCATCAGCAGTGGCAGGTGGG - Intronic
1091662400 12:2394228-2394250 CCACATCAGGAGTAGGAGGAGGG - Intronic
1095579070 12:43774779-43774801 CATCATCAGGAAAAGTAGGAGGG + Intronic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096862833 12:54542344-54542366 CCTCATCAGGACTATGTGAAGGG - Intronic
1097736948 12:63192845-63192867 CCTCATGATGGGAAGGAGGAGGG + Intergenic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1098826561 12:75305369-75305391 CCTCTCCAGGAGTCGGCGGAGGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102411027 12:112718796-112718818 CCTCTTCAGGCTTAGAAGGAAGG + Intronic
1103594506 12:122015925-122015947 CCTCCTCAGGAGGCTGAGGATGG + Intergenic
1104427950 12:128693500-128693522 CCACTTGAGGAGTAAGAGGAGGG - Intronic
1104458955 12:128938718-128938740 GCTCATCAGGAGTAGCAGCTGGG + Intronic
1106883048 13:34152662-34152684 CCTGATAAGGAGTTGTAGGAGGG - Intergenic
1107323669 13:39216326-39216348 GCTCATCAGGAGTGGGTGGCAGG + Intergenic
1108460852 13:50665996-50666018 CCTGATCACCAGTAGGAGGTAGG + Intronic
1110377748 13:74813654-74813676 CTTCATCAGGAGTATGAAAATGG + Intergenic
1110657823 13:78021099-78021121 CCTCATCAGGATTCTGTGGAAGG + Intergenic
1112032167 13:95467195-95467217 ATTCATCAAGAGTAGGAGTATGG - Intronic
1113814682 13:113162389-113162411 CCTGAGCAGGAGGAGGATGAGGG - Intronic
1113814751 13:113162599-113162621 CCTGAGCAGGAGGAGGATGAGGG - Intronic
1114813309 14:25926832-25926854 CCTCATCATGAATAGCTGGAGGG + Intergenic
1115072618 14:29343173-29343195 GCTACTCAGGAGTAGGAGGTGGG - Intergenic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118718385 14:68576350-68576372 CCTAATCACGAAAAGGAGGAAGG - Intronic
1121031458 14:90662006-90662028 CCTCATCAGGAGTAGAATCACGG + Intronic
1121058766 14:90884035-90884057 CTTCATCCAGAGGAGGAGGAGGG + Intronic
1121070240 14:91012830-91012852 CCTCAAAAGGAGCTGGAGGAAGG + Intronic
1122054113 14:99080841-99080863 GCTCTCCAGGAGCAGGAGGAAGG + Intergenic
1122357385 14:101131892-101131914 CCTAAGCAGAAGTAGGAGGAGGG - Intergenic
1122801594 14:104233031-104233053 GCTCCCCAGGAGTAGGAGGAGGG + Intergenic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1124848776 15:33315755-33315777 CCGCATCAGCAGTAGGGGGGTGG + Intronic
1124868812 15:33520446-33520468 CCTGATGAGGAGGAGGAGTATGG + Intronic
1125735559 15:41922893-41922915 CCTGAGCAGGTGTAAGAGGACGG + Intronic
1125735989 15:41926284-41926306 CCACCCCAGGAGTGGGAGGAGGG - Intronic
1126568126 15:50121540-50121562 CTTCATAAGGAGTAGAAAGACGG + Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1130686863 15:86045690-86045712 TCCTATCAGGAGTAGGAGAAAGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132032052 15:98446315-98446337 CCTCATCAGGAGAAGCCGGGAGG - Intronic
1132356552 15:101174994-101175016 CCTGATCAGGAGTGGGAGCAGGG + Intergenic
1132725637 16:1337163-1337185 CTTCAACAGGGGTAGGATGATGG - Intronic
1132860011 16:2065786-2065808 CCTCCACAAGAGCAGGAGGAAGG - Intronic
1132894916 16:2224114-2224136 GCCCATCAGGTGCAGGAGGAAGG - Intronic
1133113117 16:3561496-3561518 CCTCATCAGTAGGAAGAGGGAGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1135078807 16:19416535-19416557 CCTTATCAACACTAGGAGGAGGG + Intronic
1135423737 16:22322172-22322194 CCTGAGCAGGGGGAGGAGGAGGG + Intronic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1137011448 16:35325250-35325272 ACACATCAGGAGTCTGAGGAGGG + Intergenic
1138097233 16:54221338-54221360 CGACATCCAGAGTAGGAGGAAGG - Intergenic
1138295907 16:55884979-55885001 CCTTCTCAGCAGTAGTAGGAGGG - Intronic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139635927 16:68258406-68258428 CCTGATCAGCACTTGGAGGATGG + Intronic
1140839784 16:78827918-78827940 CCTCATTAGGAGTCAGAGTAAGG + Intronic
1141188043 16:81802521-81802543 CCTCATCAAGAGAAGGTGGTAGG - Intronic
1142256309 16:89015377-89015399 CCTCGGCAGGAGGACGAGGAGGG + Intergenic
1142901280 17:3013315-3013337 CCCCATCAGGAGGAAAAGGAGGG - Intronic
1143191784 17:5045210-5045232 CCTCACCAGGTGTAGGCTGAGGG + Intronic
1146541219 17:33697078-33697100 CCAGAGCAGGAGTAGGAGTAGGG - Intronic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1148436943 17:47692733-47692755 ACCCAGCAGGAGGAGGAGGAAGG + Intergenic
1150361020 17:64534266-64534288 CCTCACAAGGAGTAGGAAAATGG - Intronic
1151085636 17:71377389-71377411 CGTCTTCAGTGGTAGGAGGATGG - Intergenic
1151569519 17:74919358-74919380 CCTATTCAGGAGTAGGGGGTGGG - Intronic
1151581173 17:74979880-74979902 TCACATGAGGAGTGGGAGGAGGG - Intergenic
1151823962 17:76513185-76513207 GCTCAAGAGGAGGAGGAGGAAGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154084047 18:11284786-11284808 CTTCATCAGTATTAGGAGGGTGG + Intergenic
1156461759 18:37325243-37325265 CCTCATCCTGTGTGGGAGGAAGG + Intronic
1157729669 18:49992610-49992632 CATCCTCAGGAGTAAGAGGCTGG - Intronic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1160432286 18:78819923-78819945 CCTCTGCAGGAGGGGGAGGAGGG + Intergenic
1162273102 19:9632300-9632322 TCTCATCAAGAGTTGGAAGAGGG + Exonic
1164170358 19:22719677-22719699 CCTCATTATGAGCAGGATGAGGG + Intergenic
1164781538 19:30897140-30897162 CCTCATCAGGACTGGAAGGGAGG - Intergenic
1165266738 19:34667469-34667491 GCACAGCAGGAGTGGGAGGAGGG - Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1167380401 19:49134899-49134921 TGTCACCTGGAGTAGGAGGATGG - Exonic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925180712 2:1815360-1815382 CCTCATGACGAGTGGGAGCAGGG - Intronic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
929278371 2:40050140-40050162 CCTGACCAGGAGTTGAAGGAAGG - Intergenic
929527172 2:42715514-42715536 GCTACTCAGGAGGAGGAGGAGGG - Intronic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
930410889 2:51025960-51025982 CCTTCACAGGATTAGGAGGAGGG - Intronic
931158364 2:59661028-59661050 CCTCACCAGGAATAGGAACAAGG + Intergenic
938343376 2:130549682-130549704 CCTCATCGGGCGGAGGGGGACGG + Intronic
938346457 2:130571040-130571062 CCTCATCGGGCGGAGGGGGACGG - Intronic
940280105 2:151979870-151979892 CTTCAGCAGGAGTGGGAGGCAGG + Intronic
940568417 2:155399242-155399264 AATGATCAGGAGTAGAAGGAGGG - Intergenic
943675847 2:190715870-190715892 CCTCATCAGGAGTGTGTGGTGGG + Intergenic
944496788 2:200315346-200315368 CATCATCAGAAGTGGGAGGCAGG + Intronic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
1169901105 20:10552337-10552359 CCTAATTAGGAGGAGGAGAAAGG + Intronic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170155571 20:13266085-13266107 CCCCATGAGGAGTAAGTGGAAGG - Intronic
1170636578 20:18110691-18110713 TCTCATTAGGAGCAGGAGCAAGG - Intergenic
1172027111 20:31956077-31956099 GTTGATCAGGAGTAGCAGGAGGG - Intergenic
1172961003 20:38799589-38799611 CATCATCAGGAGTAGCAGCATGG + Intergenic
1173531742 20:43775000-43775022 GCTCCCCAGGAGTAGGATGATGG + Intergenic
1173866678 20:46316964-46316986 TCTCATTAGGATTAGGAAGATGG + Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1176422151 21:6524949-6524971 CCTCATCAGGGGTCTGAGGCAGG - Intergenic
1176795943 21:13371425-13371447 GCTCAACAGGAGCAGTAGGAGGG - Intergenic
1177859755 21:26438838-26438860 CCCCGTCAGGAGTGGGTGGAGGG + Intergenic
1179408239 21:41142735-41142757 CCTGAACAGGAGTTGGAAGATGG + Intergenic
1179697641 21:43133264-43133286 CCTCATCAGGGGTCTGAGGCAGG - Intergenic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1180783472 22:18534573-18534595 CCACATCCAGACTAGGAGGAGGG - Intergenic
1180837099 22:18935348-18935370 CCTCAACAGGAGGCGGGGGAAGG - Intronic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1181064858 22:20300675-20300697 CCTCAACAGGAGGCGGGGGAAGG + Intergenic
1181240374 22:21473925-21473947 CCACATCCAGACTAGGAGGAGGG - Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1184379667 22:44137426-44137448 CCTATTCAGCAGTAGGAGAAGGG + Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184430945 22:44441324-44441346 CCTCCTCAAGGGCAGGAGGAAGG + Intergenic
1203287192 22_KI270734v1_random:160647-160669 CCTCAACAGGAGGCGGGGGAAGG - Intergenic
949891230 3:8734828-8734850 GCTAATCAGGAGGTGGAGGAGGG - Intronic
950151305 3:10689660-10689682 CCTCAGCAGGATGAGGAGGATGG - Intronic
950201524 3:11048012-11048034 CCTTAACAGGGGTAAGAGGATGG + Intergenic
951642392 3:24850638-24850660 CCCCATCAGGAGTAATAGCAAGG - Intergenic
954345197 3:49991394-49991416 CCTCATCAGAAGTTGGTGGGTGG + Intronic
955349785 3:58184858-58184880 GCTCAGCAGGAAGAGGAGGAAGG + Intergenic
961678829 3:128584794-128584816 CCTCTCCAGGAGTACAAGGAGGG + Intergenic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
963027128 3:140931089-140931111 CCTCAGCAGGAATAGGTGGTGGG + Intergenic
963338355 3:144003183-144003205 CCTCCTCAGGAGTCTGAGGTGGG + Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
967630187 3:191736563-191736585 ACTCATAAAGAGTAGAAGGATGG - Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
970381377 4:15511358-15511380 ACTAATCAAGAGGAGGAGGAAGG + Exonic
972258951 4:37388886-37388908 CCATATCAGGAGCTGGAGGAGGG - Intronic
974017664 4:56663595-56663617 ACTAATCAGGAGTCTGAGGAAGG - Intronic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
979695312 4:123606570-123606592 GATCATGGGGAGTAGGAGGAGGG + Intergenic
985761646 5:1752045-1752067 CCTCACCAGGACTGGGAAGAGGG - Intergenic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
987038366 5:14039634-14039656 CCCCAGCAGGAGTAGAAGGTAGG - Intergenic
989033954 5:37150191-37150213 CCAAAGCAGGAGTTGGAGGAGGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
990737094 5:58876413-58876435 CCCCAACAGAAGTAGGAGGGAGG + Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
993844037 5:92917907-92917929 CCTCATCAGGAGGAGATGAAAGG + Intergenic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
995871310 5:116746409-116746431 CCTCATCAGTAATAGGGAGATGG - Intergenic
1001292773 5:170475879-170475901 CCTTGTCAGGAGTAGGTTGAGGG + Intronic
1002193137 5:177489260-177489282 TCTCAGCTGGAGTAGGAGTAGGG - Intronic
1002724168 5:181283490-181283512 GCTCAACAGGAGTGGTAGGAGGG + Intergenic
1002873628 6:1190562-1190584 CCTCATCAGGAGTGGATGAAAGG - Intergenic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007810561 6:44482836-44482858 CCTCTTCAGCAGCGGGAGGAAGG + Intergenic
1011868140 6:91857781-91857803 CCTCATGAGGAGTCATAGGAGGG - Intergenic
1014087838 6:117367949-117367971 ACTAACCAAGAGTAGGAGGAAGG - Intronic
1015189598 6:130458215-130458237 TCTCAACAGCACTAGGAGGAAGG - Intergenic
1016042136 6:139442327-139442349 GCTTATCACGAGAAGGAGGAAGG + Intergenic
1016050093 6:139521838-139521860 TCTCTTGAGGAGTTGGAGGATGG - Intergenic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1017871747 6:158492700-158492722 GCTCCTGAGGAGTGGGAGGATGG - Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1023821741 7:43984426-43984448 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1024933543 7:54689480-54689502 CCACCTGTGGAGTAGGAGGAGGG - Intergenic
1025189893 7:56888403-56888425 CACCACCAGGAGTAGGAGGTAGG - Intergenic
1025682046 7:63688518-63688540 CACCACCAGGAGTAGGAGGTAGG + Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029750004 7:102537845-102537867 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1029767954 7:102636951-102636973 CCTCCTCAGGAGGAGGAGCCAGG + Intronic
1030446947 7:109657758-109657780 CGTCACCAGGAGTAGGGGGTAGG + Intergenic
1031615076 7:123870342-123870364 ACTCATGAGGTGAAGGAGGAAGG + Intronic
1031975288 7:128089786-128089808 CCTCAGCAGGAACAGCAGGATGG - Intronic
1033657327 7:143382394-143382416 CCTCCTCCGGAGGAGGAGGGAGG + Exonic
1034091697 7:148370160-148370182 CCAAATCAGGGGTAGGAAGAGGG - Intronic
1035456343 7:159011460-159011482 GCTCTGCAGGAGGAGGAGGAAGG + Intergenic
1035909970 8:3555407-3555429 CCTCATCAGGAAGAGCAGGTGGG - Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1040697939 8:50024769-50024791 CATCATCGCAAGTAGGAGGAGGG - Intronic
1042216594 8:66434469-66434491 CCACAGCAGGAGTAGCAAGATGG + Intronic
1044347245 8:91119842-91119864 CTTCATCAAGGGTAGTAGGAAGG - Intronic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1045013816 8:97981598-97981620 CCACAGCAGGAGTTAGAGGAAGG + Intronic
1048472908 8:134719338-134719360 CCACATCAGGGGTTGGTGGAAGG + Intergenic
1048615326 8:136067764-136067786 CCTCATCAGAAGGAGGAAAAGGG + Intergenic
1049356294 8:142190187-142190209 CCCCATCAGGAGCAGGAAGTCGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050668853 9:7973312-7973334 CCTTAACAAAAGTAGGAGGAGGG + Intergenic
1050933115 9:11355952-11355974 ACTCCTCAGGCGTAGGATGAGGG - Intergenic
1051262210 9:15275637-15275659 CTTCATCAGGAGATAGAGGAAGG + Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1052857114 9:33414372-33414394 ACGCATCATGAGAAGGAGGAAGG + Intergenic
1053281083 9:36820138-36820160 CCAGATCAGGAGTAGGGGGCGGG - Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1056607096 9:88095072-88095094 CCTCAGCAGGAATGGGAGAATGG - Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059341283 9:113598858-113598880 CTTCATCAGGAGGAAGAGGTGGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060490911 9:124083476-124083498 CCTTATCAGGAGTAGGGAGGTGG - Intergenic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1061420574 9:130471125-130471147 CCTCATCAGGAGTATCAAGGAGG + Intronic
1062066658 9:134531584-134531606 CCTGGTCAAGAGTAGGTGGAGGG + Intergenic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1062180056 9:135186470-135186492 CCTCATCAGGATGCAGAGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1188096061 X:26023307-26023329 CCTGATCAGGATTAGGAGACAGG + Intergenic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1192167591 X:68835419-68835441 CCAGATTAGGAGTAGGAGTAAGG - Intronic
1195697720 X:107679096-107679118 CTTCATCAGGGACAGGAGGAGGG - Intergenic
1197899047 X:131348852-131348874 CCTCAGCGGGAGCAGGATGATGG - Intronic
1199686553 X:150270313-150270335 CCTCACCAGGGCTAGAAGGAAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202390892 Y:24369440-24369462 CCTTAGCAGGGGTAGGGGGACGG + Intergenic
1202479892 Y:25300676-25300698 CCTTAGCAGGGGTAGGGGGACGG - Intergenic