ID: 1127282624

View in Genome Browser
Species Human (GRCh38)
Location 15:57504873-57504895
Sequence GGCCCCATGAATCACTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127282624_1127282628 1 Left 1127282624 15:57504873-57504895 CCCTCACAGTGATTCATGGGGCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1127282628 15:57504897-57504919 GTTTGGTCAGCACCCCAAGATGG 0: 1
1: 0
2: 0
3: 10
4: 89
1127282624_1127282635 28 Left 1127282624 15:57504873-57504895 CCCTCACAGTGATTCATGGGGCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1127282635 15:57504924-57504946 TTTTTAAAACAGATGAGGGCTGG 0: 1
1: 0
2: 7
3: 87
4: 636
1127282624_1127282632 23 Left 1127282624 15:57504873-57504895 CCCTCACAGTGATTCATGGGGCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1127282632 15:57504919-57504941 GTTCCTTTTTAAAACAGATGAGG 0: 1
1: 0
2: 3
3: 44
4: 564
1127282624_1127282633 24 Left 1127282624 15:57504873-57504895 CCCTCACAGTGATTCATGGGGCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG 0: 1
1: 0
2: 5
3: 71
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127282624 Original CRISPR GGCCCCATGAATCACTGTGA GGG (reversed) Intronic
901505198 1:9680720-9680742 GGCTCCATCAATACCTGTGATGG - Intronic
903927156 1:26838849-26838871 GGCCCCATGAACCCCAGAGATGG + Intronic
906470274 1:46124029-46124051 GGCCCCAGTAAACACTGGGAAGG + Intronic
906510557 1:46408282-46408304 GCCCACCTGAGTCACTGTGAAGG + Intronic
906633898 1:47395419-47395441 GCCCCCTTGAATCCCTGGGAAGG + Intergenic
907447849 1:54520351-54520373 GGGCCCATCAATCTCTCTGAAGG + Intergenic
907673840 1:56500648-56500670 GGCCCTAGGAATCATTGTCAAGG + Intronic
910114112 1:83713799-83713821 GGCACCATGAAGTACCGTGAGGG + Intergenic
910481333 1:87661453-87661475 GACCCAATGAACCACTGAGAAGG - Intergenic
913010157 1:114675427-114675449 GGCCTCATGCATTACTGTGATGG - Intronic
917271909 1:173285150-173285172 ACCCTCATGAATGACTGTGAAGG + Intergenic
918709167 1:187705405-187705427 GTCCCCATCCATCACTCTGAAGG + Intergenic
918826987 1:189336941-189336963 CACCCCATGAAGCACTTTGACGG + Intergenic
921624904 1:217369236-217369258 GGCCCAATAAATCAATGAGAAGG - Intergenic
1064257826 10:13759340-13759362 GGGGCCATGAATTACTGTGGAGG + Intronic
1064316594 10:14263344-14263366 GGCCCCATAAATCACTTGCAAGG + Intronic
1065402350 10:25319901-25319923 GGCCCCTTGCCTCATTGTGATGG + Intronic
1065761923 10:28990591-28990613 GTCCCCATGAATCCCTGTTCTGG - Intergenic
1067534565 10:47099483-47099505 GGACGCATGAACCACTGCGAGGG + Intergenic
1069814284 10:71183886-71183908 GGAGCCAGGAATCACTTTGAAGG - Intergenic
1070087656 10:73252455-73252477 GGCCCGATGACTCACTGAGGTGG + Exonic
1070946292 10:80394718-80394740 GGCCCACTGAGTCACTGTGCTGG - Intergenic
1071551132 10:86567005-86567027 GGCCCCACGAACCCCTGAGAAGG + Intergenic
1075138101 10:119805023-119805045 GGCCCAGTGAATCATTTTGATGG + Intronic
1075807584 10:125201336-125201358 GCCCCCATGAACCACTGACACGG + Intergenic
1079523060 11:21351696-21351718 GGTCCCCTCAATCAGTGTGATGG - Intronic
1084482074 11:69427778-69427800 TGCCCCAGGTAGCACTGTGAGGG - Intergenic
1084667219 11:70582926-70582948 AGCCCCAGGAATCACTGGCAGGG + Intronic
1084731886 11:71079105-71079127 GTCCCCATGTATCCCCGTGAAGG + Intronic
1089386467 11:118071449-118071471 GGCACCTTGGCTCACTGTGAGGG - Intergenic
1090964306 11:131584873-131584895 GGCCCGATGCAGCACTGAGAGGG - Intronic
1091086773 11:132728359-132728381 AGGCCCTGGAATCACTGTGAAGG + Intronic
1091530506 12:1350436-1350458 GGCTCCATGAATCACTTTACAGG + Intronic
1095644898 12:44531881-44531903 AGCCCCATGAATAATTGTCAGGG - Intronic
1095790175 12:46158357-46158379 AGCCAAAAGAATCACTGTGAAGG + Intergenic
1096584881 12:52613601-52613623 TGCCCCATGACTCACTGTGGTGG - Intronic
1100618835 12:96252566-96252588 GCCCTCATGGATCACTTTGAAGG + Intronic
1107277429 13:38692194-38692216 GGTGCCATCAGTCACTGTGAAGG - Exonic
1110405929 13:75150409-75150431 GACACCATGAAGGACTGTGAAGG + Intergenic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113715952 13:112508052-112508074 GGCCCCAGGCAGCACTGGGATGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114846877 14:26333098-26333120 AGCCTTGTGAATCACTGTGAAGG - Intergenic
1117957052 14:61130917-61130939 GGCTCCATAAATCACTGGAAGGG - Intergenic
1121026549 14:90620562-90620584 GGCCCCATGGAGGACTGTGGGGG + Intronic
1123102982 14:105818325-105818347 AGCCCCCTGAATCACTCTGTTGG + Intergenic
1123217250 14:106822831-106822853 GTCCCCATGAAACACGGTGGAGG + Intergenic
1125608199 15:40953961-40953983 TGCCCAGTGCATCACTGTGATGG + Intronic
1127282624 15:57504873-57504895 GGCCCCATGAATCACTGTGAGGG - Intronic
1127536390 15:59893765-59893787 GGCCCCATTATTCACTGGGAAGG + Intergenic
1129948921 15:79568654-79568676 GTCCTCATGAATGACTTTGAAGG + Intergenic
1130021975 15:80239295-80239317 GGCTGCATTAATTACTGTGATGG + Intergenic
1131424777 15:92336753-92336775 GGACCCAGGAGTGACTGTGATGG - Intergenic
1132225117 15:100134295-100134317 GATCCCAGGAAGCACTGTGAGGG - Intronic
1134663402 16:16001177-16001199 GGCCTCATGGATCACTGCAAGGG + Intronic
1135687141 16:24506965-24506987 GACCCCAGGAAGCACTGTGGGGG + Intergenic
1139081048 16:63521823-63521845 TTTCCCATGAAACACTGTGATGG - Intergenic
1140650293 16:77080906-77080928 GCCCTCATGAATGACTTTGAGGG - Intergenic
1141572137 16:84940690-84940712 GGCCCCATGCATCCCAGGGAAGG + Intergenic
1143029696 17:3961037-3961059 GGCTCCAAGAATGACTGTCAAGG + Intronic
1144342115 17:14318494-14318516 GGGCCCATCACTCACTGTGGAGG + Intronic
1147652521 17:42070702-42070724 GACCCCATGAATGACTGGGATGG - Intergenic
1152600827 17:81261287-81261309 GGCCCCGTGAATGACTGGGGAGG - Intronic
1154384498 18:13880764-13880786 GGCCCCTTGCCTCACTGTGTGGG - Intergenic
1159900474 18:74040187-74040209 GGCCCTGTGAATCACAGTGAGGG - Intergenic
1160497358 18:79383340-79383362 GGCCCCATGAGTCAGTGTCAGGG - Intergenic
1161338754 19:3729187-3729209 GACCCCAAGAATTCCTGTGAAGG - Intronic
1162985136 19:14265153-14265175 AGCCCAAGGGATCACTGTGATGG - Intergenic
1163135731 19:15309830-15309852 GTACCCAAGAATCACTGTGCCGG + Intronic
1164940349 19:32247907-32247929 GGCTTCATGAATGACTTTGAGGG + Intergenic
925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG + Intergenic
925947514 2:8879592-8879614 GGGCCCATGATTCTCTGTGGTGG + Intronic
926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG + Intergenic
928653483 2:33425756-33425778 GGCCCCATTCCTCTCTGTGAAGG + Intergenic
928907659 2:36384326-36384348 GGCCTCATTTATCAGTGTGAGGG + Intronic
930160381 2:48149349-48149371 GATCCCATCCATCACTGTGATGG - Intergenic
935598807 2:104901378-104901400 GGCCTAATGAATCAATTTGAGGG + Intergenic
936368639 2:111884032-111884054 CGGCCCAAGAGTCACTGTGAAGG - Exonic
942349173 2:175034999-175035021 GGTACCATGAAACACTGAGAAGG - Intergenic
942482042 2:176398977-176398999 ACCTTCATGAATCACTGTGAGGG - Intergenic
946575331 2:221069618-221069640 GCCCTCATGGATCACTTTGAGGG + Intergenic
948317946 2:237044064-237044086 TGCCCCATGGAACACTGTGGAGG + Intergenic
948698761 2:239747690-239747712 GGACCCCTGAATCACAGTCAGGG + Intergenic
1169908870 20:10630740-10630762 TGCCCCATCAATCAATCTGAAGG + Intronic
1171784571 20:29450451-29450473 GGCCTCATGGATGACTTTGAGGG + Intergenic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1175981472 20:62740969-62740991 TGCCCCATTAGTCACTCTGAGGG - Intronic
1176081358 20:63274910-63274932 GTCCCCGTGAGTCACTGTGGTGG + Intronic
1184129463 22:42509156-42509178 GGCGCCAGGAATCTCTGGGAGGG + Intergenic
953876027 3:46667375-46667397 GGCCCCATGAAGTCCTCTGAAGG - Intergenic
954274336 3:49532614-49532636 GGCCACAAGCATCACTGTGACGG + Exonic
956720499 3:72113368-72113390 GGCTCCGTGAGTCACTGTGAGGG + Intergenic
957194701 3:77052382-77052404 GGCCCCATGAATAACTCTCAAGG - Intronic
958462669 3:94418752-94418774 TTCCCCATGAATCACTTTGTGGG + Intergenic
960583380 3:119299113-119299135 GGCCCCATGGCTCTCAGTGATGG + Intronic
960991544 3:123314736-123314758 AGCTCCATAAATAACTGTGAAGG + Intronic
961462942 3:127064488-127064510 GCCCCCATAAACCACTGAGAAGG - Intergenic
963841675 3:150114188-150114210 GATCCCAGGAAACACTGTGAGGG - Intergenic
965062643 3:163803426-163803448 GGCCCCAATAATCTCTCTGATGG + Intergenic
970537980 4:17049410-17049432 GGCCCTATGGATGACTTTGAGGG - Intergenic
979575453 4:122286001-122286023 GGTCCCATGAATAATTATGAAGG + Intronic
981464311 4:145049939-145049961 AGCCTCATGAATAACTTTGAGGG - Intronic
982169848 4:152650542-152650564 AGACCCATGAATGACTTTGAGGG - Intronic
982247688 4:153370427-153370449 GCCCCCATGTATGACTTTGAGGG - Intronic
982500135 4:156143936-156143958 GGCAACATGATGCACTGTGAAGG - Intergenic
985174484 4:187186984-187187006 GGCCCCAGGAATAAGTGAGATGG + Intergenic
985922344 5:2987377-2987399 GGCGCCATGAACAAGTGTGATGG + Intergenic
986723343 5:10576316-10576338 TGGCCCATGAACCACAGTGAAGG - Intronic
991479787 5:67065304-67065326 AGCCACAGAAATCACTGTGACGG - Intronic
992179630 5:74183703-74183725 GGCCTCATGCATGACTTTGATGG - Intergenic
1001280221 5:170381449-170381471 GTCCTCTGGAATCACTGTGAAGG - Intronic
1002910592 6:1488387-1488409 AGCCCCAAGAATGACTGAGATGG + Intergenic
1004188452 6:13443092-13443114 ATCCCCATGAATGACTTTGAGGG + Intronic
1004657973 6:17683104-17683126 GCCCCCATGGATAACTTTGAGGG - Intronic
1006047505 6:31309405-31309427 GGCCGACTGGATCACTGTGATGG - Intronic
1010262117 6:73829456-73829478 GCCCCCAGGAATCACTGGGAAGG - Intergenic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1013166085 6:107593440-107593462 GGCTCCAAGAATCACTGTGATGG - Intronic
1013448134 6:110251843-110251865 GGCCCAATGAAGCAGTATGAAGG - Intronic
1021188324 7:17591517-17591539 CACCCCATGAATCACAGGGAAGG + Intergenic
1025927899 7:65973949-65973971 GCACCCATGAACCACTGTGCTGG - Intronic
1028363189 7:89993887-89993909 GGCCACAAAAATCACTTTGAGGG - Intergenic
1031127874 7:117794592-117794614 GGTCCCATGACTGACTGTGAGGG - Intronic
1031982572 7:128137072-128137094 TGCCACAGGAATCATTGTGAGGG + Intergenic
1034465082 7:151223182-151223204 TGCCCCATCATTCTCTGTGAAGG - Intronic
1036523501 8:9514224-9514246 GCCCACATGATTCACTGGGATGG - Intergenic
1037191851 8:16135815-16135837 ACCCTCATGAATGACTGTGAGGG + Intronic
1037493009 8:19413253-19413275 GCCCCCATGAAGCGCTTTGAGGG + Intronic
1040285831 8:46099940-46099962 GGCCCCATGGATTTCTGGGAAGG - Intergenic
1042052879 8:64731038-64731060 GGCCTCAGAAAACACTGTGATGG - Intronic
1045741935 8:105370930-105370952 GTCCTCATGAACCTCTGTGATGG + Intronic
1048139305 8:131777581-131777603 TGACACATGAATCACTGTGCTGG - Intergenic
1050625983 9:7504104-7504126 AACCCCATGAAGCACAGTGAGGG + Intergenic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1051827952 9:21241993-21242015 TGTCCCATGACTCTCTGTGAAGG - Intergenic
1051831263 9:21280357-21280379 TGTCCCATGACTCTCTGTGAAGG - Intergenic
1054362051 9:64132382-64132404 GGCCACATGGATCAGTCTGAGGG - Intergenic
1055032297 9:71782992-71783014 GGGCCCATGGATCTCTGTGCTGG - Intronic
1055785603 9:79866135-79866157 GGTCCCATGACTGACTGTGCAGG - Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1059545263 9:115169356-115169378 GGCCCGATGAGAGACTGTGAGGG + Intronic
1203445180 Un_GL000219v1:47311-47333 GGCCTCATGGATGACTTTGAGGG + Intergenic
1189338586 X:40186920-40186942 GATCCCAGGAATCACAGTGAGGG + Intergenic
1200072262 X:153535126-153535148 GGCCCCGCCAAACACTGTGATGG + Intronic