ID: 1127282833

View in Genome Browser
Species Human (GRCh38)
Location 15:57506356-57506378
Sequence AGACTGTGGCTCTCATGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127282833 Original CRISPR AGACTGTGGCTCTCATGGTG AGG Intronic
901229125 1:7632148-7632170 AGGCTGTGCCTCTGATGATGAGG + Intronic
902156274 1:14489071-14489093 AGAATTTGGCTCCCAAGGTGTGG - Intergenic
902466883 1:16624051-16624073 AAACTGTGGATCTCAGGGAGTGG + Intergenic
902507717 1:16948723-16948745 AAACTGTGGATCTCAGGGAGTGG - Intronic
902533012 1:17102638-17102660 AGAGTGTCCCTCTCATGGTGAGG - Intronic
903606689 1:24580097-24580119 AGGCTGTGGCCCTCACAGTGTGG - Intronic
903732066 1:25503914-25503936 AGCCAGTGGTTCTCAAGGTGGGG - Intergenic
903856241 1:26339089-26339111 ACACTCTGCCTCTCATGGTATGG + Intronic
904843633 1:33391212-33391234 AGACAGTGGTTCTCAAAGTGTGG - Intronic
905233458 1:36529815-36529837 AGACTAGGGCTCCCAGGGTGGGG + Intergenic
905368844 1:37471839-37471861 AGACTGTGGCTCTCTCTGGGAGG + Intergenic
906876300 1:49542473-49542495 GGACTGTAACACTCATGGTGAGG + Intronic
907952585 1:59197868-59197890 GGACAGTGGCTCTCAAAGTGTGG - Intergenic
908153888 1:61332895-61332917 AGACTGTGTCACTCATACTGAGG - Intronic
912972997 1:114301635-114301657 AGCATGTGTCTCACATGGTGAGG - Intergenic
915612811 1:157008340-157008362 AGAGTAGGGCTCTCATGATGGGG + Intronic
915882868 1:159691332-159691354 AGAGTGTGGCTGACATGGTTAGG - Intergenic
916628067 1:166581129-166581151 AGAATGTGGCCCTCATGGAAAGG - Intergenic
917647783 1:177046130-177046152 AGCCTGTATCTCTCATGGTGTGG - Intronic
917794262 1:178521473-178521495 TGCCTGGGGCTCCCATGGTGGGG + Intronic
919569014 1:199222370-199222392 TTGCTTTGGCTCTCATGGTGGGG + Intergenic
922334709 1:224609378-224609400 ATACTGTTTCTCTCTTGGTGGGG - Intronic
922699623 1:227751144-227751166 ACACTGTGGCTTTGATTGTGCGG + Intronic
922981892 1:229834020-229834042 AGGCTGTGGTTCTCAAAGTGTGG - Intergenic
1065797927 10:29324085-29324107 ACACTGTGCCTCTCATGGGCAGG + Intergenic
1066016942 10:31256584-31256606 AAACAGTGGTTCCCATGGTGGGG + Intergenic
1067178601 10:43968390-43968412 AGCCTGTGGCTTTCACGGGGTGG - Intergenic
1067960073 10:50838322-50838344 GGAGTGTGGTTCTCAAGGTGAGG + Intronic
1070454688 10:76600765-76600787 AGACAGTGGCTCTCCTCATGGGG + Intergenic
1070812233 10:79304215-79304237 AGACTCTGGCTGGGATGGTGAGG + Intronic
1074122583 10:110504075-110504097 AGCCTGTGGCTTTCAAGCTGTGG + Intronic
1075292977 10:121246141-121246163 AGCCTGTGGCTCTCTTGGTAGGG - Intergenic
1075495659 10:122916547-122916569 AGACAGTGGCTCCCTTGGGGTGG - Intergenic
1076189676 10:128474227-128474249 AGACTGTGCCTCTCACGAAGTGG + Intergenic
1077232696 11:1465136-1465158 ACACTGTGGGTCTCATGCCGGGG + Intergenic
1078104738 11:8351432-8351454 CCCCTGTGGCCCTCATGGTGGGG - Intergenic
1081700802 11:45151453-45151475 AGACTGTGGCTCTGTAAGTGGGG + Intronic
1084687985 11:70708470-70708492 GGCATGTGGCTCTCGTGGTGGGG - Intronic
1086809770 11:91294257-91294279 AGACTGTGTCTTCCATGGTTGGG - Intergenic
1088244886 11:107808165-107808187 CGAGTGTGTCTCACATGGTGGGG - Intronic
1095241827 12:39869490-39869512 AGACTGTGTCTCTCAAGCTAAGG + Intronic
1098586448 12:72160250-72160272 AGTCAGTGGCTCTCAAAGTGTGG + Intronic
1101625566 12:106437395-106437417 ACACTGTGGGTCTCATTATGAGG + Intronic
1103790797 12:123469446-123469468 AGACAGCGGCTCTCATGGCCAGG - Intronic
1104190750 12:126479950-126479972 AGACTGTGGCTTCCAGGGAGGGG - Intergenic
1105669983 13:22602674-22602696 ATAGTGTGGCTCACATAGTGTGG - Intergenic
1107937378 13:45356471-45356493 CCACAGTGGTTCTCATGGTGTGG + Intergenic
1107976329 13:45692148-45692170 TCACTGTGTCTCGCATGGTGGGG - Intergenic
1108069138 13:46609701-46609723 AGACTGTGGGTATCATGAGGTGG - Intronic
1110585845 13:77191701-77191723 TGACTGTGGATCTCATGGACAGG - Exonic
1111243959 13:85510140-85510162 TGACTGTGTCTCTCTTGATGTGG + Intergenic
1111824640 13:93252208-93252230 AGACAGTGGTTCTCAAAGTGTGG - Intronic
1112753477 13:102605323-102605345 AGCCTGTGGCTTTCATCGTGGGG - Intronic
1113454605 13:110439136-110439158 AGGCTGGGGCTCTGAAGGTGAGG - Intronic
1113949569 13:114064496-114064518 TGTCCGTGGGTCTCATGGTGGGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119661187 14:76452958-76452980 AGACTGTGGTTCTCAAAGTGTGG + Intronic
1120380681 14:83775246-83775268 AGACTGTGACTCACAAGGTTAGG + Intergenic
1120861137 14:89255968-89255990 AGCCTCTGGCACTCATGGGGAGG - Intronic
1122348096 14:101072723-101072745 AGACTGTTGCTGTCCTGCTGAGG - Intergenic
1122480740 14:102045805-102045827 AGCCAGTGGCTCTCATAGTGTGG + Intronic
1124378310 15:29142555-29142577 ATGCTGTGGCTCCCATGGGGTGG + Intronic
1124464479 15:29924636-29924658 AGACAGTGGCTCTCAAGGAAAGG - Intronic
1127188349 15:56504919-56504941 AGTGTGTGGCTCTCAGGGAGAGG + Intergenic
1127282833 15:57506356-57506378 AGACTGTGGCTCTCATGGTGAGG + Intronic
1128674876 15:69601102-69601124 GGACTGTGGTTTTCATGGTTTGG + Intergenic
1129751654 15:78069529-78069551 GGACTGTGGCACTGATGGTTTGG - Intronic
1131590743 15:93746338-93746360 AGTCTGTGGCACTCATGAAGAGG + Intergenic
1132339036 15:101066428-101066450 TGACTGTGGCTTTCCTTGTGTGG - Intronic
1202952961 15_KI270727v1_random:55399-55421 AGACAGTGGCGCTCAGTGTGGGG - Intergenic
1133013216 16:2926056-2926078 AGTCAGTGGCAGTCATGGTGTGG - Intronic
1133013575 16:2928737-2928759 AGTCAGTGGCAGTCATGGTGTGG - Intronic
1134861927 16:17568023-17568045 TGACTCTGGCTCACATGGCGGGG + Intergenic
1135831584 16:25778960-25778982 AGACTTTGGCTCACATGATATGG - Intronic
1135925418 16:26689623-26689645 AGGCTGTGGCAATCATGCTGAGG - Intergenic
1137724554 16:50648175-50648197 AGTGTGTGGCTTCCATGGTGTGG - Intergenic
1139354359 16:66358538-66358560 AGACAGTGGTTCTCAAAGTGTGG - Intergenic
1140307871 16:73820461-73820483 AAACTGTGAATCTCATGGTATGG - Intergenic
1142344344 16:89544610-89544632 AGACAGTGGCTCTGAGGGTAGGG - Intronic
1142767787 17:2075380-2075402 AGACTGTGGCCATAATGCTGAGG + Intronic
1143779223 17:9220748-9220770 AGGCGCTGGCTTTCATGGTGCGG - Intronic
1143996868 17:11013993-11014015 AAAATGTGGCACTCATGGGGAGG + Intergenic
1145302857 17:21653270-21653292 TGACAGTGGCTGTCATGGGGAGG - Intergenic
1145347448 17:22049921-22049943 TGACAGTGGCTGTCATGGGGAGG + Intergenic
1148457364 17:47818263-47818285 GGACCGCTGCTCTCATGGTGAGG - Exonic
1149012736 17:51874216-51874238 AGACTGTGGCTTTCATGGCCAGG + Intronic
1151071737 17:71221659-71221681 GGACTTTGGCTCTCATATTGAGG - Intergenic
1151948110 17:77330334-77330356 TGGCTGTGGCCCTCAAGGTGTGG + Intronic
1152554776 17:81047332-81047354 GGACAGTGACTCTCATGGAGGGG + Intronic
1157768933 18:50327338-50327360 AGAATGAGTCCCTCATGGTGGGG + Intergenic
1158567196 18:58564594-58564616 AGACTGTGGCTTTCATGGTAAGG - Intronic
1159192790 18:65069770-65069792 AGGCTGTAGCTTTTATGGTGTGG - Intergenic
1162771842 19:12953858-12953880 AGACTGTGGTGATGATGGTGGGG - Exonic
1162806635 19:13140675-13140697 TGTCTTTGGCTCTCCTGGTGAGG - Exonic
1164589059 19:29496148-29496170 AGGCTGGGGCTCTCCTGGAGGGG + Intergenic
1164945785 19:32292046-32292068 AGACTGTGGCACTCACCTTGTGG + Intergenic
1167107431 19:47438474-47438496 AGAGTGTGGCTGACATGGTAAGG + Intronic
1167212010 19:48139350-48139372 AGACAGTGGATGTCAGGGTGAGG - Intronic
925284437 2:2706552-2706574 TGATTGGGGCGCTCATGGTGTGG + Intergenic
925995009 2:9285092-9285114 AGAGTGGGGCCCTCATGATGGGG + Intronic
926987627 2:18640841-18640863 AGTCTGTGGCACTCATGGAGAGG - Intergenic
927152853 2:20205677-20205699 AGACTGAGCTTCTCAGGGTGAGG - Intronic
930730349 2:54723333-54723355 AGCCTGCGGCTCTCGGGGTGAGG - Intergenic
933165346 2:79069329-79069351 AGAGAATGGCTCTCATGCTGGGG + Intergenic
933938832 2:87228628-87228650 AGACTGTGGCTATAAGGTTGAGG + Intergenic
936089826 2:109494399-109494421 AGCCTGTGGCTACCATGTTGAGG - Intronic
936238711 2:110768869-110768891 AGCCTGTTGATCTCATGCTGAGG + Intronic
936354304 2:111737147-111737169 AGACTGTGGCTATAAGGTTGAGG - Intergenic
936962619 2:118091868-118091890 AATCAGTGGCTCTCATTGTGGGG + Intronic
939976361 2:148720887-148720909 AGTCCGTGGCGCTCATGGAGAGG - Intronic
943675427 2:190711900-190711922 CAACTGTAGCTGTCATGGTGGGG - Intergenic
943896505 2:193369333-193369355 CAACTGTAGCTCTCACGGTGAGG - Intergenic
945542701 2:211108021-211108043 AGACTGTGGCTTTCATTTTGAGG - Intergenic
945977771 2:216283894-216283916 ATGGTTTGGCTCTCATGGTGGGG - Intronic
947539854 2:230968934-230968956 AGAAGATGGCTCCCATGGTGTGG + Intergenic
947850122 2:233280437-233280459 GGACAGTGGCTCTGTTGGTGAGG + Intronic
947950101 2:234139556-234139578 CGCTTGTGGCTGTCATGGTGTGG + Intergenic
948032186 2:234828017-234828039 AGAGTGTGCCTCTCCTGCTGGGG + Intergenic
1168956193 20:1836101-1836123 AATCTGTGGGTCTCAAGGTGAGG + Intergenic
1169183795 20:3594632-3594654 AGTGGGTGGCTCTCAGGGTGGGG - Intronic
1169473833 20:5911890-5911912 AGACTGAGGCTCCCCTGGTTGGG - Intronic
1170798515 20:19570921-19570943 AGACTGAGGCTCTTATCCTGGGG - Intronic
1171519446 20:25764801-25764823 TGACAGTGGCTGTCATGGGGAGG - Intronic
1171557473 20:26091690-26091712 TGACAGTGGCTGTCATGGGGAGG + Intergenic
1173351325 20:42248206-42248228 AGACTCTATCTCTCATGGAGAGG + Intronic
1173545281 20:43893015-43893037 GGACTGTGGATGTCCTGGTGAGG + Intergenic
1176522817 21:7837759-7837781 AGTCCGCGGCTCTCATGGAGAGG + Intergenic
1177968622 21:27760290-27760312 AGAATGTGGCTCTCACTGGGTGG - Intergenic
1178656837 21:34467771-34467793 AGTCCGCGGCTCTCATGGAGAGG + Intergenic
1178796633 21:35751100-35751122 AGCCTGTGGTTCTCAAAGTGTGG + Intronic
1179446277 21:41433134-41433156 AGACTGTGGTTCTCAAAGTGTGG + Intronic
1179933238 21:44585957-44585979 ACACTGGGGCTCTCAGGGTGGGG + Intronic
1179954419 21:44730280-44730302 AGGTTGTGGCCCTCATGATGGGG - Intergenic
1181427568 22:22854137-22854159 AACCTGTGGCTCTAAAGGTGGGG + Intronic
1181497013 22:23293005-23293027 AGCCTGGGGCTCTGCTGGTGGGG + Intronic
1183484154 22:38080481-38080503 ACACTGAGGCTCTCATTCTGGGG + Intronic
1184304413 22:43586720-43586742 AAACAGTGGTTCTCAAGGTGGGG + Intronic
949372916 3:3354633-3354655 ATACTGTTGCTCTCATGGGTTGG - Intergenic
953831717 3:46303444-46303466 AGACTATGGCGCTCATGATAAGG - Intergenic
953913060 3:46902439-46902461 AGCCTGGGGCTCGCAGGGTGGGG + Intronic
957288164 3:78243692-78243714 ATACTGTGGTTCTTATAGTGAGG + Intergenic
959525850 3:107375647-107375669 AGGCAGTGGCTCTCAAAGTGTGG + Intergenic
960151568 3:114253904-114253926 AGACCATGACTCTCATGGGGCGG - Intergenic
962229693 3:133651700-133651722 AAGCAGTGGCTCTAATGGTGAGG + Intronic
962284260 3:134073536-134073558 AGACTGAGGCTCTTGAGGTGTGG - Intronic
966313962 3:178625067-178625089 TGTCTTTGGCTCTCCTGGTGAGG + Intronic
967005642 3:185379825-185379847 AGGCTGTGGTTCTCAAAGTGTGG + Intronic
968276731 3:197445982-197446004 AGACTCTGGTTCTCCTGCTGAGG - Intergenic
968951829 4:3699455-3699477 AGACTTCGGTTGTCATGGTGTGG - Intergenic
969333829 4:6495153-6495175 ACACTGTGGCTCTCAGCCTGAGG - Intronic
972733789 4:41820112-41820134 TGACTGTGGCTCTGATGGGCAGG - Intergenic
972890015 4:43546271-43546293 TGACTGTGGCACTCATCGAGGGG + Intergenic
973549530 4:52019163-52019185 AGACTGTGGCTGGCCGGGTGTGG - Intergenic
975670714 4:76778171-76778193 ATACGGTGGTTCTCAAGGTGTGG - Intronic
976690669 4:87864098-87864120 AGAGAGGGGCTCCCATGGTGGGG + Intergenic
977077642 4:92476442-92476464 AAACTGTGGCACACAGGGTGAGG + Intronic
981723814 4:147827433-147827455 ATAATGTGGCTCACATGGAGTGG + Intronic
985168369 4:187122193-187122215 AGACTGTGGATCTGATGATCAGG + Intergenic
985175235 4:187193405-187193427 AGACTGTGACTCACATGGTCAGG + Intergenic
985542587 5:493781-493803 AGCCTGTGGGGCACATGGTGGGG - Intronic
986736140 5:10668765-10668787 AGGCTGGGGCGATCATGGTGGGG + Intergenic
993259000 5:85634187-85634209 AGACTCTGACTCTAATGGTTTGG + Intergenic
994186191 5:96817745-96817767 AGATTGTGGCACACATGGTATGG - Intronic
997620620 5:135290178-135290200 AGACTGTGGCTTCCATCTTGGGG + Intronic
998495467 5:142584570-142584592 CCACCGTGGCTCACATGGTGAGG + Intergenic
1001707594 5:173752893-173752915 AGAATGTGGCTCACATGGCCTGG + Intergenic
1002423926 5:179164874-179164896 TGCCTGTAGCTCTCATGGAGTGG - Intronic
1002925656 6:1604616-1604638 AGGCTGGGGCTCTCAGGCTGGGG - Intergenic
1004200171 6:13541100-13541122 AGACAGTGGTTCTCAAAGTGTGG + Intergenic
1005450820 6:25970308-25970330 AGAATGTGGCTCTGATAATGTGG - Intronic
1006840460 6:37025333-37025355 ACAGTGTGGCTCTCAGGGTCAGG + Intronic
1007101592 6:39251369-39251391 AGACAGAGGTTCACATGGTGTGG + Intergenic
1007406179 6:41637543-41637565 AGCCTGCGGCTCTCCAGGTGGGG - Intronic
1008511218 6:52277489-52277511 AGACTGTTGTTCTGATGGAGTGG - Intronic
1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG + Intergenic
1009230968 6:61060394-61060416 AGACTGTCGCTCTCACAGAGAGG - Intergenic
1009562554 6:65267402-65267424 AGACTGTGCCTCTCAAGTTGAGG - Intronic
1013167027 6:107603779-107603801 TGCCTGTGGCTCTCATGCTTTGG + Intronic
1013260397 6:108435642-108435664 AGTGTGTGGCACTCAGGGTGTGG + Intronic
1015969103 6:138726192-138726214 AGACTGTGTGTCTCATTCTGGGG - Intergenic
1016452955 6:144202448-144202470 AGCCTGTGGCTCTCAAAGTGTGG - Intergenic
1018331887 6:162738085-162738107 AAGCTGTGGCTCTCTTAGTGAGG - Intronic
1018746365 6:166765131-166765153 GGACTGTGGCTCTCTTCATGTGG - Intronic
1019695044 7:2440991-2441013 CGGCTGTGGCTCTCAGGCTGTGG + Intergenic
1020472513 7:8555137-8555159 AGCCTGTGGTTCTAATGGTCAGG + Intronic
1020493340 7:8816743-8816765 AGAGTGTGTCTCTCAGGGTCCGG + Intergenic
1020579615 7:9979509-9979531 AGATTGTGGTTCTCAAAGTGTGG - Intergenic
1022076317 7:26974348-26974370 GGTCTGTGGCTCTCATGGACAGG - Intronic
1025279931 7:57619741-57619763 TGACAGTGGCTGTCATGGGGAGG - Intergenic
1025304803 7:57845760-57845782 TGACAGTGGCTGTCATGGGGAGG + Intergenic
1028461328 7:91096346-91096368 AGAGAGAGGCTCACATGGTGAGG + Intronic
1029163304 7:98568420-98568442 AGACTGCGGCTCCCATTGTCAGG - Intergenic
1030673422 7:112362060-112362082 AGACACTGGCACTCCTGGTGGGG + Intergenic
1031353410 7:120762840-120762862 AGAATGTGGCTTCCATGGTGAGG + Intergenic
1032515687 7:132504438-132504460 AGAATGTGGGTCTCAGGATGTGG + Intronic
1032909371 7:136412393-136412415 AGACTGTGTCTCTCTGGGAGAGG + Intergenic
1033863143 7:145654803-145654825 AGACTGTGCTTCTGATGGAGAGG - Intergenic
1036961391 8:13248562-13248584 AGACTTTGCCTCCCACGGTGAGG - Intronic
1037069936 8:14631681-14631703 TGACATTGACTCTCATGGTGAGG + Intronic
1038916367 8:32028159-32028181 AGAACATGGCTCTCATGGTTAGG + Intronic
1039163258 8:34646432-34646454 AGAATGTGGCTCTGATGGGCAGG - Intergenic
1040921139 8:52619080-52619102 AGTCTGTGGCTCACATTGGGGGG - Intergenic
1041972842 8:63762106-63762128 AGTCTGCGGCACTCATGGAGAGG - Intergenic
1043525622 8:81093842-81093864 ACACTGTGACAATCATGGTGTGG + Intronic
1044018476 8:87074831-87074853 AGTCTGTGGCACTCATGGAGAGG - Intronic
1045544368 8:103114948-103114970 AAACTCTGCCTCTCAGGGTGCGG - Intergenic
1049698185 8:143993858-143993880 AGCCTGTGTTTCTCATGGGGAGG - Intronic
1050412548 9:5381904-5381926 AGACTCTTCCTCTCATGATGTGG - Intronic
1050427091 9:5522672-5522694 AGAATGTGGCCCTCAGGCTGAGG + Intronic
1051882784 9:21857045-21857067 AGATGGTGGCTCTGATGGAGTGG + Intronic
1055516656 9:77040722-77040744 AGATTGTGTTCCTCATGGTGGGG - Intergenic
1056711625 9:88996441-88996463 ATATTCTTGCTCTCATGGTGTGG - Intronic
1058625276 9:106927776-106927798 TGACTGTGGCTTTCAGGGCGGGG - Exonic
1058656957 9:107231380-107231402 AGACTGATGTTCTAATGGTGAGG - Intergenic
1058767129 9:108192478-108192500 AAACTGAGGCTCTGAGGGTGGGG - Intergenic
1059328157 9:113517290-113517312 TGAGTGTAGCTCTCACGGTGAGG + Intronic
1059705092 9:116815452-116815474 AAACTGAGGCCCTCAAGGTGGGG - Intronic
1060304911 9:122402713-122402735 TGAGTGTGGCTCACTTGGTGAGG - Intergenic
1061263444 9:129492407-129492429 TGACTGTGGAGCTCTTGGTGTGG + Intergenic
1061795610 9:133084170-133084192 AGACAGTGGCTCTCAGCCTGGGG + Intronic
1062099475 9:134720726-134720748 AGACTGTGGCTCCCAGGGGCTGG + Intronic
1186964563 X:14773096-14773118 AGTCTGTGGCACTCATGGAGAGG - Intergenic
1187176642 X:16902134-16902156 AGTCTGTGGGACTCAGGGTGGGG - Intergenic
1188681303 X:33010835-33010857 ACACTGTGGTTCTCAAAGTGTGG + Intronic
1188898807 X:35702771-35702793 AGACTGTGGCTCTAATATAGGGG + Intergenic
1189381380 X:40505024-40505046 AAATTGTGGCTCAAATGGTGGGG - Intergenic
1189502204 X:41572843-41572865 ATACTGTGGGTCTTATAGTGTGG + Intronic
1192897390 X:75458826-75458848 AGTCCGTGGCACTCATGGAGAGG + Intronic
1192925502 X:75750889-75750911 AGACTGTGGCTGATATGGTTTGG - Intergenic
1194781260 X:98028275-98028297 TGTGTGTGGCTCTCATGGAGAGG - Intergenic
1194854907 X:98916221-98916243 AATGTGTGGCTCTCATGGAGAGG - Intergenic
1195924768 X:110014528-110014550 AGAAGGTGGCTCTCATTGTTAGG + Intronic
1199181900 X:144867147-144867169 AGGATGAGGCTCTCATGATGAGG + Intergenic
1199677203 X:150198736-150198758 TGAGTGTGGCTCTCATGGTCAGG - Intergenic
1200257945 X:154594905-154594927 TTTCTGTGGCTCTCATGGAGAGG - Intergenic