ID: 1127283042

View in Genome Browser
Species Human (GRCh38)
Location 15:57508401-57508423
Sequence AGGCAAATCAAAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 561}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127283036_1127283042 2 Left 1127283036 15:57508376-57508398 CCATCTTGCCCAAGAAATGGTAA 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 561
1127283038_1127283042 -6 Left 1127283038 15:57508384-57508406 CCCAAGAAATGGTAAGTAGGCAA 0: 1
1: 0
2: 1
3: 21
4: 207
Right 1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 561
1127283039_1127283042 -7 Left 1127283039 15:57508385-57508407 CCAAGAAATGGTAAGTAGGCAAA 0: 1
1: 0
2: 0
3: 18
4: 212
Right 1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 561
1127283034_1127283042 4 Left 1127283034 15:57508374-57508396 CCCCATCTTGCCCAAGAAATGGT 0: 1
1: 0
2: 0
3: 15
4: 184
Right 1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 561
1127283035_1127283042 3 Left 1127283035 15:57508375-57508397 CCCATCTTGCCCAAGAAATGGTA 0: 1
1: 1
2: 1
3: 7
4: 120
Right 1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG 0: 1
1: 1
2: 2
3: 43
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127283042 Original CRISPR AGGCAAATCAAAAAGGAGGA AGG Intronic
900974291 1:6007603-6007625 AGGAAAATCACACAGGGGGATGG - Intronic
901485706 1:9559535-9559557 AGGCAAAAAAAAAAGGTGGGGGG + Intronic
902759492 1:18571883-18571905 AGAGAAATAAAAATGGAGGACGG - Intergenic
903050608 1:20597873-20597895 AGGCAAATAAAAAAAAAGGAAGG - Intronic
907555683 1:55342487-55342509 AAGAAAATCAAAAAGGATAATGG - Intergenic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
908645692 1:66275524-66275546 AGGGAGATAAAAAAGGAGGTTGG + Intronic
909169969 1:72282721-72282743 AGGGAAAGCGAAGAGGAGGAGGG - Exonic
910520854 1:88120731-88120753 TGGGGAATCAGAAAGGAGGATGG + Intergenic
910608966 1:89119225-89119247 AGGCATTTCAGAAAGGTGGAAGG + Intronic
910728120 1:90360085-90360107 AGGCAGCCCAAAATGGAGGAGGG + Intergenic
911295024 1:96104574-96104596 AGGCAATCCAGAAAGGATGAAGG - Intergenic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912489305 1:110052984-110053006 AGGAGAATGAAAAAGGACGAGGG - Intronic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
913203574 1:116515738-116515760 AGCCAAATTAAAAAGGAAGCAGG - Intronic
913292439 1:117286308-117286330 AGGCAGAATAAAAAGGAGGGTGG + Intergenic
913505982 1:119516588-119516610 AGGCAGAAAAACAAGGAGGAAGG - Intergenic
913669193 1:121079768-121079790 AGGAAAATCAAACAAGAGTAAGG + Intergenic
913669886 1:121087297-121087319 AGCCAAATTAGAAAAGAGGAAGG - Intergenic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
914020943 1:143867165-143867187 AGGAAAATCAAACAAGAGTAAGG + Intergenic
914021649 1:143874695-143874717 AGCCAAATTAGAAAAGAGGAAGG - Intergenic
914659437 1:149775107-149775129 AGGAAAATCAAACAAGAGTAAGG + Intergenic
914660135 1:149782646-149782668 AGCCAAATTAGAAAAGAGGAAGG - Intergenic
915063695 1:153207376-153207398 CAGGAAGTCAAAAAGGAGGAAGG + Intergenic
915063863 1:153208866-153208888 CAGGAAGTCAAAAAGGAGGAGGG + Intergenic
915585399 1:156841352-156841374 AGGTAGATCAACAATGAGGAAGG + Intronic
916448463 1:164895551-164895573 AGACAAGGCAAAGAGGAGGAAGG - Intronic
916494466 1:165333150-165333172 AAACAAAACAAAAAGAAGGAAGG - Intronic
916620500 1:166491096-166491118 AGGAAAAAAAAAAAAGAGGATGG + Intergenic
916794453 1:168153056-168153078 GGGGAATTCAAAAAGGAGGGAGG - Intergenic
916829053 1:168472571-168472593 ATCCAAATAAAAAATGAGGATGG - Intergenic
917216762 1:172686969-172686991 AGGCTAATCAAAAGGGAGAGAGG - Intergenic
917463262 1:175250893-175250915 AAGGAAATCAAAAAAGAGGTGGG + Intergenic
918299500 1:183189709-183189731 AGGAAAATCAAAGAAGAAGAGGG + Intronic
918426332 1:184413822-184413844 AGTCAAAAGGAAAAGGAGGAAGG + Intronic
918924271 1:190760669-190760691 AGGCCTATCAACAAGGAAGAAGG + Intergenic
919824207 1:201492321-201492343 AGGCAAAGCAGAAAGGAGCAGGG - Intronic
920353856 1:205356090-205356112 TGGGAACTCAAAAAGGAGGGAGG - Intronic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
923649229 1:235857635-235857657 AGGAAAACCAAAAAAGAGGGGGG + Intronic
923688883 1:236174286-236174308 ATAAAAATCAAGAAGGAGGAAGG + Intronic
923702138 1:236310286-236310308 AGGCAAATCCAAATGCAGAATGG + Intergenic
924588173 1:245378299-245378321 ACCCACATCAAAAAGGGGGAGGG - Intronic
1062771114 10:102010-102032 AGGCAAATCTGAATGGAAGAGGG + Intergenic
1062860962 10:809042-809064 AGGCAATGCACAGAGGAGGAAGG + Exonic
1064635611 10:17363363-17363385 AGGGAGCTCAAAAAGGAAGATGG - Intronic
1065661305 10:28006611-28006633 TGGCAATTCAAAAATGGGGAGGG + Intergenic
1066542079 10:36458294-36458316 AGGGACATCAAAAAGGAGCATGG + Intergenic
1067519403 10:46985064-46985086 ATGCAAATGAAAAAGATGGAGGG + Intronic
1067642844 10:48066775-48066797 ATGCAAATGAAAAAGATGGAGGG - Intergenic
1067918093 10:50422145-50422167 AGGGATCTCAAAAAGAAGGAAGG - Intronic
1068150096 10:53120802-53120824 AGGAGAATAAAAAAAGAGGAAGG - Intergenic
1069862863 10:71482171-71482193 AGGGAAGGCAGAAAGGAGGAAGG - Intronic
1071009525 10:80921487-80921509 AGGAACATCAAAAGGGTGGAAGG - Intergenic
1071925780 10:90407450-90407472 CGGTAATTCCAAAAGGAGGAGGG - Intergenic
1072528375 10:96295093-96295115 AGGAAAATCCAAGAGGAGGCTGG - Intergenic
1072573505 10:96678744-96678766 AGGAAAAGTGAAAAGGAGGAAGG - Intronic
1073932813 10:108595716-108595738 AGGAAAAACAAAAAGGAACAAGG + Intergenic
1074393032 10:113073752-113073774 AAGCAAATAAAAAAGGAGATCGG - Intronic
1074452522 10:113570758-113570780 AGGCCAATCAGAAAGCAGAAAGG + Intronic
1074571409 10:114627697-114627719 AGGCCCATAAATAAGGAGGAAGG + Intronic
1075654752 10:124153403-124153425 AGGGAAATAAGAAAGGGGGAGGG + Intergenic
1075950967 10:126477449-126477471 AGGCAAAACACAAAGGAGTGTGG - Intronic
1077003840 11:341117-341139 AGGAAAAGGAAAGAGGAGGAAGG + Intergenic
1077647894 11:3942462-3942484 AGGCACATCCAAATGGAAGAGGG - Intronic
1078406187 11:11071817-11071839 GGACAAACGAAAAAGGAGGAAGG - Intergenic
1079362039 11:19777420-19777442 GGGCAGAGGAAAAAGGAGGAGGG - Intronic
1079445567 11:20553668-20553690 AGGAGAAAGAAAAAGGAGGAAGG - Intergenic
1080140367 11:28911268-28911290 AGGGAAAGAAAAATGGAGGATGG - Intergenic
1080296427 11:30734995-30735017 AGAAAAAGGAAAAAGGAGGATGG + Intergenic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1081578715 11:44336627-44336649 AGAAAAATTAAAAAGGAGAATGG - Intergenic
1082679192 11:56147799-56147821 AGCCAAATCAGACAGTAGGATGG + Intergenic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1084379005 11:68798708-68798730 AGATAAACCAAAGAGGAGGATGG + Intronic
1084894501 11:72255778-72255800 AGAGAAAACAAAAAGAAGGAAGG - Intergenic
1084979899 11:72823466-72823488 AGGCAAATCAAGAAGGATGGAGG - Intronic
1086021114 11:82230978-82231000 AGGTAGATAAAAAAGGAGAATGG - Intergenic
1086670065 11:89535561-89535583 AGGGAAAGCAAAAAGCAGAAAGG - Intergenic
1087202282 11:95357805-95357827 AAGTAAACCAAGAAGGAGGAGGG - Intergenic
1088325709 11:108598773-108598795 AGGGACATAAAAAAGGAGGTTGG + Intergenic
1088334437 11:108687871-108687893 AGTGAAAGAAAAAAGGAGGAGGG - Intronic
1088415719 11:109586804-109586826 AGGAAAAGAAGAAAGGAGGATGG + Intergenic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1088489658 11:110374485-110374507 AGCCAAAGAAAAAAGGAGGAAGG - Intergenic
1088543859 11:110940410-110940432 TGAGAAATCAAAAAGGAGTAAGG - Intergenic
1089081879 11:115783019-115783041 AGGAAAATCAAAACCCAGGAAGG - Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1090049274 11:123362979-123363001 AAGCAAGCCAAAGAGGAGGAGGG + Intergenic
1090479824 11:127058400-127058422 TGGCAAGTTAGAAAGGAGGAAGG + Intergenic
1090703722 11:129317861-129317883 AGGAAAATAAACAAGGAGAAGGG - Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1091270190 11:134305084-134305106 AGAGAAAGCAAAAAGGAAGATGG - Intronic
1091533245 12:1380436-1380458 AGGCAAATCAACAAGTCTGATGG + Intronic
1091915546 12:4270064-4270086 AGGCACATCAAGAGGAAGGAGGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1095211266 12:39497960-39497982 TGGGGAATCCAAAAGGAGGAGGG + Intergenic
1095261465 12:40104557-40104579 AGGAAAAACAAAGAGGAGAATGG + Intronic
1095380048 12:41580191-41580213 ATACAAATCAAAAAATAGGATGG - Intergenic
1095508430 12:42923471-42923493 AGTCAAAACAAAAAGGAGAAGGG - Intergenic
1095963328 12:47849697-47849719 AGTCAAAACAAAAATGGGGATGG - Intronic
1097146631 12:56944192-56944214 ATCCAAATTAAAAAGGAAGAAGG - Intergenic
1097681765 12:62656011-62656033 ATGGAAAACAAAAAGGAAGAGGG + Intronic
1098014331 12:66088455-66088477 GGGCAGATCATGAAGGAGGAAGG - Intergenic
1099070632 12:78042057-78042079 AGTGAAAACAGAAAGGAGGAGGG - Intronic
1100758439 12:97778002-97778024 AGGAAAAGAAAAAAGAAGGAAGG - Intergenic
1101324844 12:103706509-103706531 AGAAAAATGAGAAAGGAGGAGGG - Intronic
1101868916 12:108546161-108546183 TGGGAAATCAACAAGGAAGAGGG + Intronic
1101900786 12:108789754-108789776 AAGCAAAGCAGGAAGGAGGAGGG + Intronic
1103425252 12:120828437-120828459 ACTCAAATCAAATAGAAGGAAGG + Intronic
1104131700 12:125899961-125899983 AGGAAAAGCAAAAGGAAGGAAGG - Intergenic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104225930 12:126833047-126833069 AAGCAAAACAAAAATGAGGCAGG - Intergenic
1104296409 12:127518801-127518823 TGGGAAATCAACAAGGAAGAGGG - Intergenic
1104781261 12:131422032-131422054 AGGCAGGAGAAAAAGGAGGAGGG - Intergenic
1105682971 13:22748496-22748518 ACTCAAATCAACAAGAAGGATGG + Intergenic
1106537657 13:30661910-30661932 AGGCAAACTCAAAAGGAGCAAGG - Intergenic
1107138098 13:36966811-36966833 AGCAAAAGCCAAAAGGAGGAAGG - Intronic
1108341704 13:49504018-49504040 AAAAAAATCAAAAAGGAGGCTGG - Intronic
1108421073 13:50250170-50250192 AGGATAATCAATAATGAGGAAGG - Intronic
1108490199 13:50974380-50974402 AGGAAAAAGAAAAAGGAGGGAGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109209444 13:59517650-59517672 TGGCAAAACAAAAAGCAGCAAGG - Intergenic
1109498760 13:63211053-63211075 AGATAAAACAAAAAGGAGGAAGG - Intergenic
1109629137 13:65020994-65021016 AGTCAAATCAAAATGGATTAAGG - Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1111064758 13:83075218-83075240 AGGGAAAACAAAATGGAGCAGGG + Intergenic
1111129425 13:83955410-83955432 AGGCAACTCAGCAAGGAGGATGG - Intergenic
1111823020 13:93236094-93236116 AGGCAATTCTAAAATGAGAAGGG - Intronic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1112046391 13:95602257-95602279 AGGCAAAGCAAACAGTAAGAAGG - Intronic
1115775604 14:36711436-36711458 AGACAAATCATTAAGAAGGAAGG - Exonic
1115853988 14:37610389-37610411 AGGCAACTAAAAAATGAGGTGGG - Intronic
1116010618 14:39347391-39347413 AGGCAAACATAAAAGGAGGGAGG + Intronic
1116656397 14:47658528-47658550 AGGAAACTCACAAAAGAGGATGG - Intronic
1116900518 14:50358060-50358082 AGAAAAAGAAAAAAGGAGGAGGG - Intronic
1117051647 14:51866318-51866340 AGTGAAATAAAAAAGGAAGAAGG - Intronic
1118899458 14:69974312-69974334 AGGTGTATCACAAAGGAGGAGGG + Intronic
1118978168 14:70695086-70695108 AGGCCAATCAAGAAAGAAGAAGG + Intergenic
1119604041 14:75999156-75999178 GGGCAAAGCAAAATGGAGTATGG - Intronic
1119938096 14:78611418-78611440 AGGAAAAAAAAAAAAGAGGAGGG - Intronic
1120317211 14:82910611-82910633 AGACAGGGCAAAAAGGAGGAAGG + Intergenic
1121593299 14:95137291-95137313 AGGCAAAAGAAAAAGGAAAAGGG + Intronic
1121787330 14:96672107-96672129 AGCCCAATCAAAGTGGAGGAAGG + Intergenic
1122259075 14:100501893-100501915 AGGCAATGCAGAGAGGAGGATGG + Intronic
1122736410 14:103846287-103846309 AAGGAAATCAAAGAGGAAGAAGG + Intronic
1123715071 15:23022255-23022277 AGGCAGGGCAAAATGGAGGACGG + Intronic
1124067294 15:26356115-26356137 AGGCAAAACAGAAGGGAGGGAGG + Intergenic
1124147088 15:27137883-27137905 AGGCAGATCAACAAGTAGAAGGG - Intronic
1124791453 15:32731075-32731097 AGGCACATCCGGAAGGAGGAAGG + Exonic
1125152027 15:36543715-36543737 AGTCAAGTCGAAAAGGTGGAGGG + Intergenic
1125156970 15:36598668-36598690 AGGAAAATAGAAAGGGAGGAAGG - Intronic
1125177934 15:36846931-36846953 AGAGAAATCAAGAAGGAGGATGG - Intergenic
1125309970 15:38368058-38368080 AGACAAAACAAAAAGCAGGAAGG + Intergenic
1126485919 15:49180851-49180873 AGATAAATCAAAAAGAGGGAAGG - Intronic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127917786 15:63469635-63469657 ATGAAAAACAAAAAGGAGGCTGG + Intergenic
1127946802 15:63763524-63763546 AGGAAAAGAAAAATGGAGGAGGG + Intronic
1128224234 15:65990637-65990659 AGGAAAAGAAAAAAGAAGGAAGG + Intronic
1128323652 15:66709151-66709173 AGGCAACTAAAAAAGTATGAAGG - Intronic
1128581951 15:68817281-68817303 AGGCAAAAATAAAAGGGGGAAGG + Intronic
1128663381 15:69520026-69520048 AGCCCAATTAAAAAGTAGGATGG + Intergenic
1129923180 15:79338370-79338392 AGGCAAAGTAAATAGAAGGATGG + Intronic
1130889892 15:88124814-88124836 AGGCAAATTATAAAGGTGGATGG - Intronic
1131607204 15:93919147-93919169 AGGCAACTCAAAGTGGAGGTGGG - Intergenic
1134264814 16:12683908-12683930 AGGCAAAACAGAAAGATGGAAGG - Intronic
1134896930 16:17896673-17896695 AGGAAAAAGAAAAAGGAGAAAGG + Intergenic
1135204689 16:20473472-20473494 AGGCAAAGCAATAAGGAATATGG + Intronic
1136509313 16:30726077-30726099 AGAGAAATAAAAAAGTAGGATGG - Intronic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1137317420 16:47340704-47340726 ACTCAAATCAAAAAGGAGATTGG + Intronic
1137322988 16:47404915-47404937 GGGCAAATCAAAAATAAGAAAGG - Intronic
1137467224 16:48720784-48720806 AGGCAAATCAAAGAGGAGGAGGG - Intergenic
1139190235 16:64854923-64854945 AGGGACATCAAAAAGGGGCATGG + Intergenic
1139254257 16:65526134-65526156 AGGCAAAAGAAAAAGGAAAAAGG + Intergenic
1139582442 16:67881395-67881417 AGGAAAAGCAAGAAGGATGATGG + Exonic
1139749456 16:69100478-69100500 AAGCAAAACAGAATGGAGGATGG - Intergenic
1140236788 16:73166353-73166375 AGACAAATCAAGAAGGAAGCTGG + Intergenic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1140916384 16:79497513-79497535 AGGCAAATTAAAAAAGAGCTAGG - Intergenic
1141258465 16:82427209-82427231 TGTCAAATAAAAAAGAAGGATGG + Intergenic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1143121938 17:4613567-4613589 AGGTAAAAAGAAAAGGAGGAAGG - Intergenic
1145251331 17:21298411-21298433 AGGAAAATCCAAGAGGAAGAAGG + Exonic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1146073211 17:29703102-29703124 AAGGAAATCAAAGAGTAGGATGG + Intronic
1146499938 17:33355542-33355564 AAGAAATTCAAAAGGGAGGAAGG - Intronic
1147326366 17:39671618-39671640 AGGCAAGGAGAAAAGGAGGATGG + Exonic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149053017 17:52329322-52329344 AGGCAAAAAGAAAAGGAGCAAGG - Intergenic
1150455491 17:65303810-65303832 AGGCAAAACATATAGTAGGATGG + Intergenic
1150677836 17:67259937-67259959 AAGAAAAGAAAAAAGGAGGAGGG + Intergenic
1151159254 17:72150997-72151019 AGAAAAATGGAAAAGGAGGAGGG + Intergenic
1152029010 17:77830345-77830367 AGCCAAAGCAAAAAAGAGGCAGG + Intergenic
1152047541 17:77947482-77947504 AGGAAAATCAAGAAGGAAGAGGG + Intergenic
1152292042 17:79445568-79445590 AGGGAAATCACAGGGGAGGAGGG - Intronic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153766160 18:8376746-8376768 AGGAAAAACAAAAAGGGGGAAGG - Intronic
1155033347 18:22003127-22003149 AATCAAATTAAAAATGAGGACGG - Intergenic
1155240997 18:23863449-23863471 AAACAAAACAAAAAGGAGGAGGG + Intronic
1155289412 18:24325591-24325613 AGGAAAATAAAATAGGATGAAGG - Intronic
1155431191 18:25760581-25760603 AGGTAAATCACAGAGGAGGCGGG + Intergenic
1155707299 18:28832087-28832109 AAGCAAAAAAGAAAGGAGGAGGG + Intergenic
1155977891 18:32151350-32151372 AACTAAATCAAAATGGAGGAGGG - Intronic
1155980877 18:32178038-32178060 AGCCAATTTAAAAGGGAGGATGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156438808 18:37163359-37163381 AGGAGGAACAAAAAGGAGGAAGG - Intronic
1156592083 18:38501821-38501843 AAGGAAGTGAAAAAGGAGGAAGG + Intergenic
1156822716 18:41392034-41392056 AGAGAAAGAAAAAAGGAGGAGGG + Intergenic
1157130363 18:45001717-45001739 CTGCAAAGCAAAAAGGAGAAGGG - Intronic
1157791388 18:50534467-50534489 AGACAAAAAAAAAAGAAGGAAGG - Intergenic
1157804817 18:50650236-50650258 AAGCAACTCAAAAAGAAGGCAGG + Intronic
1158370635 18:56798952-56798974 AGGGAAAGAAAAAGGGAGGAAGG - Intronic
1158818197 18:61128122-61128144 AGTCATAGCAGAAAGGAGGAAGG + Intergenic
1159011132 18:63059456-63059478 AGGCAAATCAAAAAGGCAAGGGG + Intergenic
1159039631 18:63311662-63311684 AGGCAAAACAAGAAGCAGAATGG + Intronic
1159390400 18:67786067-67786089 AGGCAAAGCAAAAAAAAGCAGGG - Intergenic
1159448958 18:68575821-68575843 AGGAAAAAAGAAAAGGAGGAAGG - Intergenic
1159893697 18:73976907-73976929 AAACAAACCAAAAAGGAAGAGGG + Intergenic
1160954211 19:1682657-1682679 AGGGAAATCAAACAGGATCATGG - Intergenic
1162251600 19:9448853-9448875 ATGCAAAACAAAAAAGAGCACGG + Intergenic
1164757400 19:30700362-30700384 AGGAAAGTAAGAAAGGAGGAAGG - Intronic
1165313050 19:35040101-35040123 GTGCAAATCAGCAAGGAGGAGGG - Intronic
1165373748 19:35426864-35426886 AGGGAAAGCAAGAAGCAGGATGG - Intergenic
1165385343 19:35507252-35507274 ATCCAAATCAAAAGGAAGGAAGG + Intronic
1166354878 19:42221000-42221022 TGGCAACTCAAAAATTAGGAAGG + Intronic
1167245384 19:48370026-48370048 AGGCAAAGGAGAAGGGAGGATGG + Intronic
1167665452 19:50820830-50820852 AGACAAATGAAAAAGGACGCGGG + Intronic
924973042 2:148431-148453 ATGGAAACCAAAAAGGAGCAAGG - Intergenic
925106059 2:1293382-1293404 ACGCAAATCTAGAAGAAGGAAGG - Intronic
925336712 2:3103938-3103960 AGAAACATCAAAAAAGAGGATGG + Intergenic
925470138 2:4152107-4152129 AGGCAGACAAAAAAGAAGGAAGG - Intergenic
925511039 2:4625805-4625827 AGGAAATTCAAAAAGGAAAAGGG - Intergenic
926332189 2:11834850-11834872 CTGCAAATAAAAAAGGAGCAGGG + Intergenic
926429307 2:12769595-12769617 AGGCAAGAAAAAAAGGAGGAAGG + Intergenic
926447416 2:12960724-12960746 AGACAAACAAAAAAGAAGGAAGG + Intergenic
926969873 2:18455803-18455825 AAGCAAATCTGAAAGGCGGAGGG + Intergenic
926998455 2:18765858-18765880 ATGAAAGTCAAAAAGAAGGAGGG + Intergenic
927855651 2:26526106-26526128 AGGAAAAGAAAAAAGGTGGAAGG + Intronic
928012328 2:27621433-27621455 AGACTAATCATAAACGAGGAAGG + Exonic
928072118 2:28227457-28227479 AGTCAAATCAAAACTGAGGCTGG - Intronic
929120465 2:38480111-38480133 AGACACATCCAAAAGCAGGAGGG + Intergenic
929162200 2:38843500-38843522 AGAAAAATCAAAAATGAAGAGGG - Intronic
929311141 2:40427259-40427281 AAACAAACCAAAAAGGGGGAGGG - Intronic
930404303 2:50935406-50935428 AGGCAAATAAAAACTGAGTAGGG + Intronic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
930950130 2:57131331-57131353 TGGAGACTCAAAAAGGAGGAGGG - Intergenic
931690058 2:64828038-64828060 AGGCAAAGAAGAAAGGAGAAAGG - Intergenic
932716959 2:74107944-74107966 AGGCAAACCAATAAAGTGGAAGG - Exonic
933379479 2:81524555-81524577 AGGAAAAGAAAAAGGGAGGAAGG - Intergenic
933505744 2:83175129-83175151 AGGCAAATAAAAGAAAAGGAAGG + Intergenic
934079921 2:88458981-88459003 AGTCTAATGAAGAAGGAGGAGGG - Intergenic
934156694 2:89207603-89207625 GGGCAGAGAAAAAAGGAGGAGGG + Intergenic
934210622 2:89975148-89975170 GGGCAGAGAAAAAAGGAGGAGGG - Intergenic
935037976 2:99397523-99397545 AGATAAATCCAAATGGAGGAGGG - Intronic
935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG + Intronic
935416561 2:102825265-102825287 AGACAATTCAAAAAGGACAAAGG + Intronic
935524380 2:104147660-104147682 AGACAAATCAAACAGGAGTTAGG + Intergenic
935644260 2:105320488-105320510 AGGCAATGCAGAAAGGAGGCAGG + Intronic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
937669931 2:124527751-124527773 AGTTAAAGCAAAAAGGAGGAAGG + Intronic
939590231 2:144055421-144055443 AGGTAATTAAAAAAGGAAGAAGG + Intronic
939727949 2:145746582-145746604 AGGCAAGCAAAGAAGGAGGAAGG + Intergenic
939745692 2:145964105-145964127 AGGCAAAAAAAAAAGGAGGGGGG - Intergenic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
940087942 2:149882574-149882596 AGGCAATGCTAAAAGGAAGAGGG - Intergenic
940204112 2:151183642-151183664 TGGCAGCTCAAAGAGGAGGAGGG - Intergenic
940214581 2:151291102-151291124 AGGCAAATGATACAGGTGGAGGG + Intergenic
941067387 2:160919005-160919027 AAGTCAAACAAAAAGGAGGATGG + Intergenic
941698975 2:168583461-168583483 AAGCAAATGAAAAAGAAGCAAGG - Intronic
941885571 2:170523928-170523950 AGGCAAAGAAGAAAGGAAGAGGG + Intronic
942197705 2:173538076-173538098 AGGGAAGTCAAAAAGGGGAAAGG - Intergenic
942715265 2:178884569-178884591 AAGGAAAACAAAAAGGAGGGAGG - Intronic
942745279 2:179224955-179224977 TAGCAAATCAAAACTGAGGAGGG + Intronic
943575934 2:189631077-189631099 AGGAAAAACAAAAGGAAGGAGGG + Intergenic
944518189 2:200533638-200533660 GGGCAAAAAAAAAAGGAGGTGGG + Intronic
944888717 2:204093794-204093816 ATCCAAATCAGAAAGGAAGAAGG - Intergenic
945393518 2:209294350-209294372 CAGAAAATCAAAAAGGAGTATGG + Intergenic
945563039 2:211362029-211362051 AGGAAGATCAAAAAGAAAGAAGG - Intergenic
945807565 2:214508951-214508973 AGGCAAGACAAGAAGGAGGAAGG - Intronic
945831064 2:214785619-214785641 AGTTAAAACAAAAAGAAGGAAGG + Intronic
945879379 2:215310932-215310954 AAGCCTATTAAAAAGGAGGATGG + Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
946875853 2:224129184-224129206 AGAAAAACCCAAAAGGAGGATGG - Intergenic
947929083 2:233948496-233948518 AGCCACATCAAAGAGGAAGAGGG + Intronic
948294454 2:236850217-236850239 AGGCAAGGCCAAAAGGAGGATGG - Intergenic
948570879 2:238916472-238916494 AGGGAAAGAAAGAAGGAGGAGGG + Intergenic
1169055369 20:2616557-2616579 AGGAAAATAAAGAAGGAGGGAGG + Intronic
1169559206 20:6781307-6781329 AGAGAAATCAAAAGGGTGGATGG - Intergenic
1170520723 20:17182052-17182074 ATGGAAATCAAAAAGAAGCAGGG + Intergenic
1171149370 20:22813577-22813599 ATGCAAGTCAAAAACGACGAAGG + Intergenic
1171573758 20:26277954-26277976 AGGCACAGCAAGAGGGAGGATGG - Intergenic
1171940762 20:31327081-31327103 AGCCTAATCAAAGAGGAGAAAGG + Intergenic
1172617560 20:36299185-36299207 AGGAAAGGCGAAAAGGAGGAAGG - Intergenic
1173276930 20:41593189-41593211 AGCCCAATCAAAAAGGGGGGGGG + Intronic
1174187698 20:48718502-48718524 ACAGAAATCAAAAAGAAGGACGG + Intronic
1175068035 20:56306949-56306971 AGGAAAATCAACAAGGAGTGGGG + Intergenic
1175829829 20:61957560-61957582 TGGAGAATCAAAGAGGAGGAGGG + Intronic
1177602452 21:23334024-23334046 AAGCAATTGAAAAAGGGGGAGGG + Intergenic
1177833075 21:26161443-26161465 AGACAGAATAAAAAGGAGGAAGG - Intronic
1177914031 21:27065670-27065692 AGACAAAACAAAAAAGAGAAAGG + Intergenic
1178385576 21:32146532-32146554 AGGCAAAAAAAAAAAAAGGAAGG + Intergenic
1178476140 21:32939004-32939026 TGGCAATTCAAAATGGAGGAAGG + Intergenic
1178925271 21:36769494-36769516 AGGAAAAACAAAAAGGAGGGGGG + Intronic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1181282254 22:21728266-21728288 AGGCAAAGCTAAAAGCAGGGAGG - Intronic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182142912 22:27978047-27978069 CTGAAAATCACAAAGGAGGAAGG + Exonic
1182259869 22:29066046-29066068 AGACAAAAAAAAAAGGAAGAAGG - Intergenic
1182638578 22:31749436-31749458 AGGCGAAAAATAAAGGAGGAAGG + Intronic
1184760876 22:46543469-46543491 AGGGAAATAAAAAGGGAGGGAGG - Intergenic
1184837072 22:47030038-47030060 ATGCAAATGAGAAAGGAGGTGGG + Intronic
1185155379 22:49190617-49190639 AGGAAAATAGAAAAGAAGGAAGG + Intergenic
949485142 3:4530983-4531005 AAGCCAAGCACAAAGGAGGAAGG - Intronic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
951305551 3:21056519-21056541 AAGAAAATGAAAAATGAGGAGGG + Intergenic
951322828 3:21267952-21267974 AGCTAAAGCAGAAAGGAGGAGGG + Intergenic
951806399 3:26648918-26648940 AGGCAACTCAAAAATAAGAATGG + Intronic
952419349 3:33117528-33117550 AGGCCAAGCAAAAAGTAGGCCGG + Intronic
952983133 3:38754653-38754675 GGGCAAAGCAAGAAAGAGGAGGG + Intronic
953147198 3:40289756-40289778 TGGGAAATAAGAAAGGAGGAGGG + Intergenic
953243299 3:41168490-41168512 AGGCAAAGCAAAGAGAAGGAGGG - Intergenic
953244115 3:41175372-41175394 TGAAAAATCACAAAGGAGGAGGG - Intergenic
953329789 3:42043382-42043404 AGGCAAAGAGACAAGGAGGAGGG - Intronic
954990795 3:54839341-54839363 AAACAAATCAAAAAGTGGGAGGG + Intronic
955194457 3:56792196-56792218 AGCACAATGAAAAAGGAGGAAGG + Intronic
955315002 3:57931096-57931118 ATGAAAATCATAAAGGTGGAAGG - Intergenic
955595682 3:60587949-60587971 AGGGAAAAAAAAAAGGAGAAGGG - Intronic
955695618 3:61633026-61633048 CGCCAAATCAAGAAGAAGGATGG - Intronic
956317178 3:67951078-67951100 AGGCACAACAAAAATGATGAAGG + Intergenic
957373088 3:79321739-79321761 AGGCAGATCAAAACAGAGAAAGG + Intronic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
957908805 3:86593918-86593940 ATCAAAATCAAAAAAGAGGAGGG - Intergenic
958076066 3:88680002-88680024 AGGAAAATAAAAAAAGAGTATGG - Intergenic
959143672 3:102517523-102517545 ACGCAAATCAATAAGAAGAAAGG - Intergenic
959330921 3:105003663-105003685 TGGAAAATCAAAAAAGAGAAAGG + Intergenic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
959936584 3:112035776-112035798 AAGAAAATAAAAGAGGAGGAAGG + Intronic
960411464 3:117331804-117331826 AGGCAGAACAAAAAGGATGTAGG - Intergenic
961212040 3:125132883-125132905 AGGCAAGTCAGAGAGTAGGAGGG + Intronic
961405105 3:126672800-126672822 AGGGAGATCAACAAGGTGGAAGG - Intergenic
961663887 3:128484693-128484715 ATGCAAAACAAACAGGAGAAAGG + Intronic
962446935 3:135474231-135474253 AGGAAAATTTCAAAGGAGGAGGG - Intergenic
963197864 3:142553576-142553598 AAGCAAATAAAAATGGAGAATGG + Intronic
963367882 3:144362271-144362293 AGGCAAATAAAAAAATAGAAAGG + Intergenic
963538097 3:146553673-146553695 AGTAAAATTAAAAAGGAGGGAGG + Intergenic
963563940 3:146903815-146903837 AGAAAAATGAAAAAAGAGGAAGG + Intergenic
964530631 3:157663993-157664015 AGGCAACTCAAAATGGAAGAGGG + Intronic
964929640 3:162001622-162001644 AGGCACATGAAAAAATAGGAAGG - Intergenic
966090188 3:176124785-176124807 AGGCACATCTAAAAGGCGGTAGG - Intergenic
966426365 3:179784172-179784194 TGGCAAATTAAAAAGGCGTATGG - Exonic
967147036 3:186615138-186615160 AGGGAAAAGAAAACGGAGGAAGG + Intronic
967269758 3:187723651-187723673 AGACAAATAAAAAATGAGCAGGG + Intronic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
967333882 3:188320978-188321000 AGGAAAATCAAACAGGACCAAGG - Intronic
967727648 3:192876784-192876806 AGCCAGACCAAAAGGGAGGAAGG - Intronic
967869027 3:194214424-194214446 AGGTAAACCAAGAAGGAGGAAGG + Intergenic
967895573 3:194393774-194393796 TGACAAATCAAAAAAGAGGAAGG + Intergenic
968143152 3:196274881-196274903 ATGCAAATTAAAATGGAAGAAGG + Intronic
969941850 4:10740062-10740084 AGACAAAGCTAAGAGGAGGAGGG + Intergenic
970144253 4:13017140-13017162 ATCCAAATCAGAAAGGAAGAAGG + Intergenic
970145138 4:13028186-13028208 AAACAAATCAAAAAGGATGGAGG + Intergenic
971000844 4:22320826-22320848 AGGCAAATAAAAAAGAAGGGTGG - Intergenic
971040555 4:22747359-22747381 AGGCAAATCAAAGTGGTAGAGGG - Intergenic
971661028 4:29415888-29415910 AGGCAAAACCAAAAGCATGAGGG + Intergenic
972222036 4:36966808-36966830 AGGGAGATCACACAGGAGGAGGG - Intergenic
972244098 4:37226303-37226325 AGGCTAATCCAAATGGAAGAGGG + Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972695370 4:41439911-41439933 AGAAAAAACAAAAAGGAGGAGGG + Intronic
972722945 4:41719052-41719074 AGGAATTTGAAAAAGGAGGAAGG + Intergenic
972951731 4:44333811-44333833 AGGCAAATCCAAAAGTAAAAAGG + Intronic
974061307 4:57038450-57038472 AGGCAAAACAAAAAGCGGGGCGG - Intronic
974711975 4:65609029-65609051 AGGAAAGTGAACAAGGAGGATGG - Intronic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
975349937 4:73333882-73333904 AGGCAAAAAAAAAAGTAGCAAGG - Intergenic
975659747 4:76676640-76676662 AGACAAAGGAAAATGGAGGAGGG + Intronic
977460260 4:97316414-97316436 AGACAATTCACAAAAGAGGAAGG + Intronic
977460377 4:97318076-97318098 AGGCAAGTCATCAAGCAGGATGG + Intronic
977492636 4:97733965-97733987 ACCCAAATCAGAAAGGAAGAAGG - Intronic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
978835487 4:113144679-113144701 ATGCAAATAACAAATGAGGAAGG + Intronic
981046107 4:140266801-140266823 AAGAAAATAAAAAGGGAGGAAGG + Intronic
981206652 4:142048881-142048903 AGGCAAATAAAATAGGACCAGGG + Intronic
981248019 4:142563386-142563408 AGGCAAATTGAAAAGGAATAAGG + Intronic
981937027 4:150249509-150249531 AGACAACTCAAACGGGAGGATGG + Intronic
983038959 4:162901675-162901697 AGGCAAATCCCAAAGGGGGATGG + Intergenic
983547936 4:168982236-168982258 ATGGAAAACAAAAAGGAGCAGGG + Intronic
983717311 4:170798840-170798862 TGGCAAATCATTAAGGAGAATGG - Intergenic
984269071 4:177528733-177528755 AGGCAAGTCATAAGGGAGGAGGG + Intergenic
984447974 4:179861596-179861618 TTGCAAATCAAGGAGGAGGAAGG + Intergenic
984830746 4:183970554-183970576 AGGGGAATCACACAGGAGGAAGG + Intronic
985055275 4:186030647-186030669 AGGCTATTCACGAAGGAGGAAGG + Intergenic
986265471 5:6186562-6186584 AGACAAATCATAAAGCAGAAAGG - Intergenic
987163822 5:15173293-15173315 AGGGAAATAGAAAAAGAGGAAGG + Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987928888 5:24377470-24377492 CGGGAAAGCACAAAGGAGGAAGG - Intergenic
988567294 5:32329633-32329655 AGGAAAATGACAAAGGAGGCTGG + Intergenic
988874748 5:35431618-35431640 AGTCAAGTCAAAAAGGAGTCTGG - Intergenic
990470715 5:56112629-56112651 AGGCAAATTATAAAGGAAAAAGG + Intronic
990534613 5:56707986-56708008 ACAGAAAACAAAAAGGAGGAGGG + Intergenic
991360372 5:65813549-65813571 AGGGAAATCAATAAGGGGAATGG - Intronic
992302745 5:75400835-75400857 AGGCAAACTAAAGAGGAAGAAGG - Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
993201566 5:84822738-84822760 AGTCAAAACAAATAGGATGATGG + Intergenic
993402929 5:87474895-87474917 ACGGAAAGCAAAAAAGAGGAAGG + Intergenic
993559062 5:89380897-89380919 AGACAGGTAAAAAAGGAGGAAGG - Intergenic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994753410 5:103765676-103765698 GGGAAAATAAAAAAGGAAGAAGG + Intergenic
995342100 5:111071496-111071518 GGGCAAAGCAAAAAGGAGGAAGG + Intronic
996618189 5:125467320-125467342 AGCCCAAACAAATAGGAGGAGGG + Intergenic
996870520 5:128187182-128187204 AGGTTAATCAAAAATGGGGAAGG + Exonic
997020957 5:130001178-130001200 AGGCACATAAAAAAGAAGGCAGG - Intronic
998827913 5:146123607-146123629 CTGCAAATCAAAAGGGAGGGGGG + Intronic
998934051 5:147215670-147215692 AGGAAAAGAAAAAAGAAGGAAGG + Intergenic
999296364 5:150461849-150461871 AGAAAAATAAAAAAGGAGGAGGG - Intergenic
999824091 5:155257772-155257794 AGGAAAATGGAAAAGCAGGAAGG - Intergenic
999930320 5:156425310-156425332 AGGCAGTTTAAAAAGGAGGCTGG - Intronic
1000222823 5:159230533-159230555 AGGAAAATCAAAAAGAAGAGTGG + Intergenic
1001091362 5:168743677-168743699 AGACATATCAAAAACGAAGACGG + Intronic
1001666260 5:173435894-173435916 AGGCAGAGCAAAAAAGAGGGTGG - Intergenic
1002382315 5:178839621-178839643 AGGCAAATCACAGAGGTGGCTGG + Intergenic
1002864277 6:1107522-1107544 AGGCCAATCAGAAAGGATGCAGG - Intergenic
1003927340 6:10888459-10888481 AGGAAAATCAGAAAGTGGGATGG - Intronic
1004002189 6:11605662-11605684 AGACAGATTATAAAGGAGGAAGG + Intergenic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004761960 6:18677214-18677236 AGACAAAGCAAAATGCAGGATGG + Intergenic
1004789918 6:19013657-19013679 CTGGAAGTCAAAAAGGAGGAGGG + Intergenic
1005028406 6:21486471-21486493 AGTGAAATAAAACAGGAGGAGGG - Intergenic
1005315752 6:24601215-24601237 AGGAAAAACATAAAAGAGGAAGG + Intronic
1005367662 6:25095455-25095477 AGGCAAATGTAAAATGACGAAGG + Intergenic
1005438969 6:25844622-25844644 AGGCAAATAAAAAAGGCTGAAGG + Intronic
1006426946 6:33970467-33970489 AGCCAAAGCAAAGAGAAGGAGGG + Intergenic
1007274721 6:40664883-40664905 AGAGAAATCAAACAGGAAGAAGG + Intergenic
1007745477 6:44040618-44040640 AGGCAAGAAACAAAGGAGGAAGG - Intergenic
1007875659 6:45098126-45098148 AGCCAAAGAAAAAAGCAGGAAGG + Intronic
1008728388 6:54450095-54450117 AGGGAATTCCAAAAGGAGAAGGG + Intergenic
1009248280 6:61267545-61267567 AGGAAAAGGAAAAAGGAGGCAGG + Intergenic
1009787296 6:68356427-68356449 TGGGAAATAAAAAAGGAGCAGGG - Intergenic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010355237 6:74924835-74924857 GGTGGAATCAAAAAGGAGGATGG + Intergenic
1010381077 6:75225468-75225490 CAGAAAATCAAAAAGCAGGAAGG + Intergenic
1010800246 6:80166929-80166951 AGGCATACCAAAAAAAAGGAGGG - Intronic
1010851636 6:80783970-80783992 AGGAAAATTAACAAGGAGAAAGG + Intergenic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1012538110 6:100324372-100324394 ATGGAAAACAAAAAGGAGCAGGG - Intergenic
1012680768 6:102176062-102176084 AAGGAAAACAAAAAGGAGAAAGG - Intergenic
1012712377 6:102623929-102623951 AGGTAAAGCAAAAAGGAAGCAGG + Intergenic
1013580048 6:111524679-111524701 AGGCAAATAAACAAGTAGGAAGG - Intergenic
1014189308 6:118474581-118474603 AGGCAAGTCAAAAAGATGTAGGG + Intronic
1015146559 6:129993940-129993962 AGGCACATCAGAAAGGTAGAAGG - Intergenic
1015366468 6:132401824-132401846 AGGCAGAGGGAAAAGGAGGAGGG + Intergenic
1015383022 6:132591396-132591418 GGGCAGGTCAAAAAGAAGGAAGG + Intergenic
1015400696 6:132785056-132785078 AGGAAAAGAAAAAAGGGGGAGGG + Intronic
1016375705 6:143418463-143418485 AGGGAAACAAAAAAGGAGAAGGG + Intergenic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1016830119 6:148425734-148425756 GGGAAAAAAAAAAAGGAGGAGGG - Intronic
1017239114 6:152147545-152147567 AGGCCAATCACAAAGCAGGGAGG + Intronic
1017332055 6:153210848-153210870 AGGAAAATGAAAAAGGAGAATGG - Intergenic
1017578389 6:155832396-155832418 AAGCAAAGAAAAAAGGAGGAAGG - Intergenic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1018049689 6:159997928-159997950 AGGGAAATCAAACAGGAGCTGGG - Intronic
1018891071 6:167982921-167982943 AGGCAATTCAAAAACAAGGATGG + Intergenic
1019642469 7:2111465-2111487 AGATCAATGAAAAAGGAGGAAGG + Intronic
1020378369 7:7514158-7514180 ATATAAATCAAAATGGAGGAGGG + Intronic
1021275082 7:18640503-18640525 AGGCAGGGAAAAAAGGAGGAAGG - Intronic
1022536178 7:31100037-31100059 AGGGAAAGCAGAAAAGAGGAGGG - Intronic
1022663938 7:32391941-32391963 AGGCAAAACAAGCAGGAGGAAGG + Intergenic
1022752605 7:33246212-33246234 AGGCAAATCAAAATGAATTAGGG - Intronic
1022925252 7:35050320-35050342 AAGCAAAAAAAAAAGGATGAAGG - Intergenic
1023390991 7:39711558-39711580 AGGCAAATGAGAAAGGATGGAGG - Intergenic
1023668954 7:42555934-42555956 AGGAAATTCAAAAAGGACTAAGG + Intergenic
1024923316 7:54584958-54584980 AGGTAAAAGAGAAAGGAGGAAGG - Intergenic
1025481396 7:60988144-60988166 AAGAAAAGAAAAAAGGAGGAGGG - Intergenic
1026203298 7:68233694-68233716 AGTAAAATTAAAAAGGAGGCCGG + Intergenic
1026584665 7:71646669-71646691 AGGCAACTCATAAAGAAGCATGG - Intronic
1027802144 7:82767968-82767990 AAGAAAAGCAAAAAGGAGGGAGG + Intronic
1028329657 7:89573733-89573755 AGAAAAATGAAAGAGGAGGAGGG + Intergenic
1028558727 7:92149993-92150015 AGGCAAATCCAAGTGGAGGAGGG - Intronic
1028941539 7:96527172-96527194 AGTGAAATGAGAAAGGAGGATGG + Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1029786618 7:102798210-102798232 AGGGAAGTAAATAAGGAGGAAGG + Intronic
1029845105 7:103404955-103404977 AGTCAAATCAAACAGAAGAAAGG - Intronic
1030034781 7:105399670-105399692 AGACAAAACAAAAAGGAATAGGG + Intergenic
1030319301 7:108147108-108147130 ATGCAAATCACCATGGAGGAGGG + Intergenic
1031118723 7:117696395-117696417 AGGCAGATTAAAAAGAAGAAAGG - Intronic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033724635 7:144101404-144101426 GAGTAAATCAAAAAAGAGGATGG - Intergenic
1033883752 7:145918694-145918716 AAGCAAATAAAAATGAAGGATGG + Intergenic
1034184111 7:149161143-149161165 AGCCAGAGCAAAGAGGAGGAGGG - Intronic
1034611301 7:152372002-152372024 CGTCAAATCACAAAGGAAGACGG + Intronic
1034730599 7:153384170-153384192 AGACAAATTAGAAAGGAGAAGGG + Intergenic
1035929409 8:3764165-3764187 GTGCAAATCTAAATGGAGGAGGG - Intronic
1036053610 8:5226862-5226884 AGGAAAATGAAGAAGGAGGGAGG - Intergenic
1036714749 8:11110343-11110365 AAGCAAAGCAAAAAGGAGCCAGG + Intronic
1036805853 8:11832831-11832853 AGGCAAAGGAAAAATGATGAGGG - Intronic
1037094803 8:14972977-14972999 AGGCACACAAAGAAGGAGGAAGG - Intronic
1037222418 8:16540245-16540267 GTGCAAATCATAAAGGAAGAAGG + Intronic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037738269 8:21583814-21583836 AGGGAAATGAAAAGGGGGGAAGG - Intergenic
1037902407 8:22695417-22695439 AGCCAAATCGAGAAGGAGAAGGG - Intergenic
1037981111 8:23255090-23255112 CGGCTTTTCAAAAAGGAGGAAGG - Intronic
1038324191 8:26560016-26560038 AGGCAAAGGAAAGTGGAGGAAGG - Intronic
1038504840 8:28075330-28075352 AGGCACATCCAAAAGAAGAAGGG + Intronic
1039712745 8:40073157-40073179 AGGAAAATCTAAATAGAGGAAGG + Intergenic
1039843924 8:41312262-41312284 AAGCCATTCAAAAAGGAGGGAGG - Intergenic
1041093086 8:54321986-54322008 AGGCTAACTAAAAAGAAGGAGGG + Intergenic
1041648283 8:60276138-60276160 GAGCAACTCAAAAAAGAGGATGG + Intronic
1042006778 8:64189458-64189480 AGACAAAGGAAAAAGAAGGAAGG + Intergenic
1042539993 8:69898365-69898387 AGGAAAAAAAAAAAGGAAGAAGG - Intergenic
1043166493 8:76909251-76909273 GGGCAAATAAGAAAGGAGAAAGG - Intergenic
1043706881 8:83361204-83361226 AGAAACATCAAAAAGGAGCAGGG + Intergenic
1043911830 8:85873464-85873486 AGGAAAATCAACAAAGAGAAAGG - Intergenic
1044008977 8:86968103-86968125 AGCCAAATCCACCAGGAGGAAGG - Intronic
1044482585 8:92709770-92709792 AGCCAAAGCAAAAAGCAGGTGGG + Intergenic
1044899447 8:96928233-96928255 TGGAAAAGCACAAAGGAGGAAGG - Intronic
1045663066 8:104458042-104458064 AGGGAAAACAGAAAGGAAGAGGG + Intronic
1046221252 8:111218429-111218451 AGGGAAAGGAAAAAGAAGGAAGG - Intergenic
1046737610 8:117793934-117793956 AGGAAAATAGGAAAGGAGGAAGG + Intergenic
1047482105 8:125293563-125293585 AGGGAACACAAACAGGAGGAAGG + Intronic
1047521772 8:125600485-125600507 AGGCAGAGCAGAAAGGAGGCTGG - Intergenic
1047935309 8:129770685-129770707 AATCAAATCACAAAGGAAGATGG + Intronic
1048020009 8:130529673-130529695 AGGCACATCGAAAAGGTGGGTGG + Intergenic
1048469453 8:134694614-134694636 AGGCAAATGAACTAGGAGGATGG - Intronic
1048578460 8:135711156-135711178 AAGCAAAGCAAAAAGAGGGAAGG + Intergenic
1048627342 8:136199768-136199790 AGGGAAATCAAAGAGTAGAAAGG + Intergenic
1048957869 8:139551756-139551778 AGGAAATTCAAAGTGGAGGAGGG + Intergenic
1049263881 8:141654741-141654763 ACCCAAAGCAAACAGGAGGAAGG - Intergenic
1049485773 8:142859344-142859366 AGGAATTTCAAAACGGAGGACGG - Intronic
1049864631 8:144926286-144926308 AAGGAAATCAACAAGGATGAGGG + Intergenic
1050174774 9:2858422-2858444 AGGAACATAAGAAAGGAGGAAGG - Intergenic
1050760311 9:9061495-9061517 GGGCAAAGAGAAAAGGAGGAAGG - Intronic
1050765596 9:9129446-9129468 ACGTAAATAAGAAAGGAGGAAGG - Intronic
1050957442 9:11682440-11682462 AGGGAAAGAAAAAAGAAGGAAGG + Intergenic
1051059497 9:13029767-13029789 AGGAAAATAAAACAGGATGACGG + Intergenic
1051352420 9:16210260-16210282 AAGCAAGGGAAAAAGGAGGAAGG + Intronic
1052111904 9:24596161-24596183 AGGAAAAACAAAGAGGGGGAGGG - Intergenic
1052409154 9:28100730-28100752 AGACAATTCAAAGTGGAGGATGG - Intronic
1052903415 9:33814836-33814858 AGGCCAAAAAAAAAGGAGGGGGG + Intergenic
1053058540 9:35009375-35009397 ATGCAAAGCAAAAAAGAGAATGG + Intergenic
1054386627 9:64561752-64561774 AGGCAATTTACAAAGGAAGAAGG - Intergenic
1054950230 9:70842263-70842285 AGGCATTTAAAAAAGGAGGTAGG - Intronic
1055099065 9:72444510-72444532 AGACAAATCAAAATAGAGAATGG + Intergenic
1055650635 9:78403603-78403625 AGGCAGATGAAAAAGGAAAAAGG - Intergenic
1055866198 9:80816796-80816818 AGGAAAATTAACAAAGAGGAAGG + Intergenic
1055899185 9:81214712-81214734 AGCCAAATGAAACAGAAGGAAGG - Intergenic
1056027311 9:82512368-82512390 AGAAAAATCATATAGGAGGAGGG + Intergenic
1056615428 9:88161261-88161283 AGTCAAAGCAAAAAGGATTAGGG - Intergenic
1057967625 9:99519416-99519438 GGGGGAATCAAAAAGGAAGAAGG + Intergenic
1058777934 9:108303484-108303506 AGGCAATTCAAAAAGTAGCATGG + Intergenic
1059406368 9:114100146-114100168 AGGCAAAGCAAACAGGAGTCAGG + Intergenic
1059541965 9:115139219-115139241 AGGCAAAGCAAGAAGGTGGTGGG - Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1060370988 9:123070841-123070863 AAGAAAATAAAAAAGGTGGAGGG - Intronic
1060704383 9:125784707-125784729 AGGAAAAACAAAAAGAAGAAAGG + Intronic
1060906206 9:127308297-127308319 AGACAAACCCAAAATGAGGAGGG + Intronic
1061488465 9:130932554-130932576 AGGCCAGTGGAAAAGGAGGAGGG - Intronic
1061764625 9:132873993-132874015 AGGCAAATCAGACACGGGGAAGG + Intronic
1062157315 9:135060223-135060245 AAACAAACCAAAAAGGAGCAAGG + Intergenic
1185684553 X:1917642-1917664 AGGCAAAAGAAAAAGAAGGGGGG + Intergenic
1185739292 X:2517950-2517972 AGGAAAAGAAAAAAGAAGGAAGG - Intergenic
1186145638 X:6621627-6621649 AGGGAAGGAAAAAAGGAGGAAGG + Intergenic
1186402363 X:9271507-9271529 AGGCAAAGCAAAAAGCACAAGGG + Intergenic
1186713452 X:12225561-12225583 AGGGAAATAAAAAAGGAGGAGGG - Intronic
1186720146 X:12295562-12295584 AGAAAAAACTAAAAGGAGGAAGG - Intronic
1187114308 X:16333369-16333391 AGGCAAAGAAGAAAGCAGGAGGG - Intergenic
1187264480 X:17718675-17718697 AAGGAAAGCAAAAAGGAAGAAGG + Intronic
1187897163 X:23993028-23993050 ATGGAAATCAAACAGGAGTAGGG - Intronic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1189386833 X:40543942-40543964 TGGCAAATAGAAAAAGAGGAGGG + Intergenic
1189738365 X:44094297-44094319 AAGAAAAGAAAAAAGGAGGAAGG - Intergenic
1190431766 X:50384850-50384872 AAGCAAAAAAGAAAGGAGGAAGG + Intronic
1190618597 X:52263261-52263283 AGGGAAATAAAGAAGGAGGGAGG - Intergenic
1191071804 X:56408865-56408887 ATGGAAATCAAAAAGTAGCAGGG - Intergenic
1191900789 X:66039075-66039097 ATACAAATCCCAAAGGAGGATGG - Intronic
1192094206 X:68193299-68193321 ATTCAATTGAAAAAGGAGGAAGG + Intronic
1192479045 X:71469004-71469026 AAGCAAAACAAAATGGAGGCTGG + Intronic
1192870901 X:75182992-75183014 AGTAAAATAAAAAAGAAGGAAGG - Intergenic
1193211967 X:78817385-78817407 AGACACATTAAAAAGAAGGAAGG + Intergenic
1193850722 X:86534181-86534203 AGGCAAATCAAAACAAAAGATGG + Intronic
1194271059 X:91816293-91816315 AGACAAATTAAAATGGAGAAGGG + Intronic
1194511865 X:94806548-94806570 AGGAATATGAAAAAGGTGGATGG - Intergenic
1194545026 X:95223228-95223250 AGGCTATTTAAAAAGGAGGGAGG + Intergenic
1194604098 X:95959684-95959706 AGTCACATGAAAAAGGAGAAAGG + Intergenic
1195658811 X:107358765-107358787 AGGGAAGACAAAAAGAAGGAAGG + Intergenic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196739406 X:119011289-119011311 AGGCACAGCTGAAAGGAGGAAGG - Intronic
1197092425 X:122555224-122555246 AGGCAAAGAGAAAATGAGGAAGG - Intergenic
1197801965 X:130360060-130360082 AGAAAAAAAAAAAAGGAGGAAGG - Intronic
1197982629 X:132233578-132233600 TTCCAAATTAAAAAGGAGGAAGG - Intergenic
1198474582 X:136983299-136983321 AGCCAGATCAAGAAGGAGGTGGG - Intergenic
1198532738 X:137561752-137561774 AGGCAAAAAAAAAAGGGGGGGGG + Intergenic
1199087851 X:143649649-143649671 AACTAACTCAAAAAGGAGGAAGG - Intergenic
1199683440 X:150243293-150243315 AGGGTAAACAAAAAGAAGGAAGG + Intergenic
1200588300 Y:5037735-5037757 AGACAAATTAAAATGGAGAAGGG + Intronic
1200746134 Y:6905504-6905526 AGGAAAATAGAAAAGAAGGAAGG - Intergenic
1200817058 Y:7544553-7544575 AGAGAAATCAAAAAGGATTATGG + Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic