ID: 1127284201

View in Genome Browser
Species Human (GRCh38)
Location 15:57518292-57518314
Sequence ACCGAAGACACCCATAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127284201_1127284202 10 Left 1127284201 15:57518292-57518314 CCATATCTATGGGTGTCTTCGGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1127284202 15:57518325-57518347 TTCCATTGAGTCAGTTTCATAGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127284201 Original CRISPR ACCGAAGACACCCATAGATA TGG (reversed) Intronic
908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG + Intergenic
922191694 1:223324409-223324431 ACCCAAGACACCAATATTTAAGG + Intronic
1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065528793 10:26648266-26648288 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065558110 10:26936731-26936753 CCAGAAGACACCCAAAGGTAGGG - Intergenic
1069288475 10:66746129-66746151 ACCGAAGACAGCCAGAGAGATGG - Intronic
1070033152 10:72696521-72696543 ACAGAAGACAACAATAGAAAAGG - Intronic
1070130231 10:73650874-73650896 ACCCCAGACTCTCATAGATATGG + Intronic
1073919336 10:108441140-108441162 GCCTCAGACACCCGTAGATATGG + Intergenic
1074792614 10:116905872-116905894 ACTGAAGACACGCACAGTTATGG + Intronic
1075600520 10:123764772-123764794 ACAGAAGAAACCCAAAGAAAGGG - Intronic
1076986921 11:244353-244375 AACCAAGACACCCTTAGGTAGGG - Intronic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1084189855 11:67493994-67494016 ACCGAAGTCACCAATAGCTCGGG - Exonic
1088447030 11:109942272-109942294 ACCTAAGATACCCATAATTATGG - Intergenic
1096877495 12:54641921-54641943 ACCGAAGACCCCTTTAGAAATGG + Intergenic
1097601874 12:61703154-61703176 ACCACAGATACCAATAGATATGG + Intergenic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1099296510 12:80834745-80834767 ACAGAAGACACTGATACATATGG - Intronic
1103251347 12:119502681-119502703 AAGGAAGACACCCCTGGATATGG + Intronic
1110597734 13:77337691-77337713 TCTGAAGACTCACATAGATATGG + Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1118820791 14:69344464-69344486 ATAGAAGAGACCCATAGAGAAGG + Intronic
1126076245 15:44913128-44913150 ACCCAAGACATACACAGATAAGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1139089106 16:63622114-63622136 ACTGAAGACATCCCTACATAGGG + Intergenic
1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG + Intronic
1147920255 17:43911962-43911984 ACAGCAGACAGCCAGAGATAAGG - Intergenic
1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG + Intronic
1158034322 18:53006083-53006105 ACTGAAGACACACATATATGTGG - Intronic
1158912934 18:62085917-62085939 ACCATAGACACCCACAGAAATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1162911367 19:13849546-13849568 CCTGAAGACTCCCACAGATATGG + Intergenic
1165394006 19:35554165-35554187 ACTGAAGATACACAGAGATAGGG - Intronic
932908131 2:75776500-75776522 ACTTCAGAAACCCATAGATAAGG - Intergenic
935861389 2:107334205-107334227 ACTGAAGACACCTATGAATAAGG - Intergenic
940881305 2:158949536-158949558 ACTTAAGTCACCCATAGAAAAGG + Intergenic
944306651 2:198187178-198187200 ACCAAAGACCACCATAGAGAAGG - Intronic
945064026 2:205933067-205933089 GATGAAGACACCCATAGATTTGG - Intergenic
945787871 2:214266138-214266160 TACAAAGACACTCATAGATAAGG - Intronic
947328592 2:229004373-229004395 ACTGAAGAAACCAATACATAGGG + Intronic
1168937731 20:1681410-1681432 ACCACACACACACATAGATAAGG - Intergenic
1169322774 20:4647871-4647893 ACCAATGACAACCATACATAAGG + Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
956051039 3:65248793-65248815 ACCCAAGGCACCCAGAGATGGGG - Intergenic
957688961 3:83542580-83542602 GCCAAAAACACACATAGATAGGG - Intergenic
971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG + Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
983054427 4:163085110-163085132 ACCGAAGACACCCAGAGTACTGG - Intergenic
985434648 4:189917086-189917108 CCAGAAGACACCCAAAGGTAAGG - Intergenic
987481233 5:18460850-18460872 AACGATGACACCCAAAAATATGG - Intergenic
993154195 5:84201292-84201314 ACTGAAAACATTCATAGATAAGG - Intronic
995381775 5:111543331-111543353 ACAGAGGACATACATAGATAGGG + Intergenic
999939837 5:156530419-156530441 ACTGAAGTCAGCCATAAATACGG - Intronic
1004029823 6:11855949-11855971 ACAGAAGACACTAGTAGATAGGG + Intergenic
1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG + Intergenic
1012561737 6:100589469-100589491 GACTAAGATACCCATAGATAAGG - Intronic
1014807431 6:125845848-125845870 ACCAAATATACACATAGATATGG - Intronic
1015680991 6:135808247-135808269 ACCGAAATCACTCATAGATAAGG - Intergenic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1017778019 6:157694780-157694802 ACAGAAGACAACTATAGACATGG + Intergenic
1021048092 7:15948117-15948139 ACAGCACACACCCATAGCTAGGG - Intergenic
1028287342 7:89018861-89018883 AGAGAAGACACACATAAATAAGG - Intronic
1028981192 7:96969796-96969818 GCCGAAGACAGCCATTGATTTGG - Intergenic
1038885718 8:31660564-31660586 ACAGAAGTTACCCAAAGATAGGG - Intronic
1050260069 9:3831932-3831954 CCCAAAGACAACTATAGATATGG - Intronic
1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG + Exonic
1193525732 X:82586098-82586120 AACAAAGACACCCATTCATATGG + Intergenic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1200835633 Y:7728675-7728697 ACAGAAGACACCCAGAGGTTAGG - Intergenic