ID: 1127284202

View in Genome Browser
Species Human (GRCh38)
Location 15:57518325-57518347
Sequence TTCCATTGAGTCAGTTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127284199_1127284202 16 Left 1127284199 15:57518286-57518308 CCACTGCCATATCTATGGGTGTC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1127284202 15:57518325-57518347 TTCCATTGAGTCAGTTTCATAGG 0: 1
1: 0
2: 0
3: 17
4: 194
1127284196_1127284202 22 Left 1127284196 15:57518280-57518302 CCATAGCCACTGCCATATCTATG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1127284202 15:57518325-57518347 TTCCATTGAGTCAGTTTCATAGG 0: 1
1: 0
2: 0
3: 17
4: 194
1127284201_1127284202 10 Left 1127284201 15:57518292-57518314 CCATATCTATGGGTGTCTTCGGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1127284202 15:57518325-57518347 TTCCATTGAGTCAGTTTCATAGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127284202 Original CRISPR TTCCATTGAGTCAGTTTCAT AGG Intronic
901688715 1:10959064-10959086 TTCCATTGGGGCTGTTTCCTAGG + Intronic
903151865 1:21415381-21415403 TTCCATAGAGCCAAGTTCATAGG - Intergenic
906851098 1:49251195-49251217 CTCCAGTGAGGCAGTTTCAATGG + Intronic
910090069 1:83451661-83451683 TTCCTTTGAGTCTCTGTCATTGG + Intergenic
910185386 1:84533699-84533721 TTCCTTTAAGTCAGTGTCTTTGG + Intergenic
910514111 1:88038262-88038284 TTTAATTGACTCAGTTTCACAGG - Intergenic
913101909 1:115575587-115575609 TTTAATTGACTCAGTTTCACAGG + Intergenic
921232271 1:213084975-213084997 TTCCACTGTGTTAGTTTCCTGGG + Intronic
922385642 1:225078996-225079018 TTTAATTGACTCAGTTCCATAGG - Intronic
924153277 1:241150669-241150691 TTCTATTGATTCAGTCTCTTTGG - Intronic
1063065556 10:2605103-2605125 TTTTATTGAGTCAATTCCATCGG + Intergenic
1063192046 10:3704749-3704771 TTCCAATGTTTTAGTTTCATTGG + Intergenic
1063555120 10:7071516-7071538 TTCCATTATGACAGTTTCACAGG + Intergenic
1063760439 10:9068609-9068631 TTCCCCTGAGTCTGTATCATGGG + Intergenic
1065730253 10:28703895-28703917 TTGCTTGGAGTGAGTTTCATAGG + Intergenic
1068612385 10:59074567-59074589 TTCCATTTTTTCAGTTGCATAGG + Intergenic
1068881657 10:62055707-62055729 CCCCATTGAATCAGTTTCAGAGG + Intronic
1072428683 10:95352275-95352297 TTCCATGGGGTCATTTTAATGGG - Intronic
1072736653 10:97883667-97883689 TTCATTTGTGTCAGTTTCAGTGG + Intronic
1073687786 10:105775208-105775230 TTCTATTGAGTCAGGTTTATAGG - Intergenic
1074312688 10:112336116-112336138 TTGGAGGGAGTCAGTTTCATGGG - Intergenic
1078280456 11:9895929-9895951 TTCTATAGGGTAAGTTTCATTGG - Exonic
1078638592 11:13075286-13075308 CACCATGGAGGCAGTTTCATGGG - Intergenic
1079120854 11:17683919-17683941 TTTCAATTAGTCAGTTTCATTGG - Intergenic
1079673066 11:23191470-23191492 CTCTATTGAGTCATTCTCATTGG + Intergenic
1080220030 11:29892075-29892097 TTCAATTAAGTCAGTTTCTAAGG - Intergenic
1081315112 11:41622533-41622555 TTTAATTGACTCAGTTTCACAGG - Intergenic
1082855353 11:57801321-57801343 TGGCATTGAGTCAGTTGCTTTGG + Intronic
1084081897 11:66832757-66832779 ATCCATTGTATCAGTTTCCTGGG + Intronic
1084843594 11:71879966-71879988 TTCCATTTAGTGAGTATCAGTGG - Intronic
1085375214 11:76054178-76054200 TTCCATTCTGTCAGTTGCTTAGG + Intronic
1086127689 11:83366019-83366041 GTCCATTCAGTCAGTTGCAAGGG + Intergenic
1086604140 11:88674686-88674708 TTCCATTGACTCAGTGTCTTGGG + Intronic
1086742772 11:90387838-90387860 ACCCATTGAGTCAATATCATTGG - Intergenic
1090960937 11:131555991-131556013 TTCCATTGACTCTGTTCCCTTGG - Intronic
1094161908 12:27399447-27399469 TGCCATTAACTCAGTTTCCTAGG + Intronic
1098768948 12:74527952-74527974 TTCTATTGATTCTGTTTCACTGG - Intergenic
1100592622 12:96043647-96043669 TTCCATTTAGAGAGTTTTATTGG + Intergenic
1100898594 12:99213377-99213399 TTCCCTTAAGTCTGTCTCATAGG + Intronic
1103180673 12:118908666-118908688 ATCCATGAAGTCAGTTGCATAGG - Intergenic
1104031316 12:125067166-125067188 TTCCACAGAGTCATTTTCCTAGG + Intronic
1106327287 13:28705752-28705774 ATACATTAAGTCAGTTTAATTGG + Intronic
1107784520 13:43941746-43941768 TCCCATTGACTCTGTTTCACTGG + Intergenic
1108010636 13:46005145-46005167 TTCCAGTGAGTAATTTTCAAGGG - Intronic
1109585065 13:64389402-64389424 TGCCATGAAGTTAGTTTCATTGG + Intergenic
1110149888 13:72238753-72238775 TTTCATTGACTCAGTTCCACAGG + Intergenic
1112167952 13:96940060-96940082 TTCCATTAAGTCACTTCCAGAGG - Intergenic
1113497222 13:110740778-110740800 TTCCATATGGTCAGTTCCATAGG + Intergenic
1114156678 14:20111327-20111349 ATCGACTGAGTCAGTTTCTTAGG + Intergenic
1114300294 14:21370482-21370504 TTTCATTCTGTCAGTGTCATAGG + Exonic
1115307783 14:31950273-31950295 TTCCATTGTCTCACTGTCATTGG + Exonic
1115437264 14:33388830-33388852 TTCCATTGTGCCTATTTCATAGG + Intronic
1116939554 14:50777286-50777308 AACCATTGATTCTGTTTCATGGG - Intronic
1117370240 14:55071648-55071670 CTTCATTTAGTGAGTTTCATCGG + Intergenic
1119586747 14:75842886-75842908 TTCCTTTGAGTCAGCCTCAAAGG + Intronic
1122336592 14:100992681-100992703 TTCCACTGATTCAGTCACATAGG - Intergenic
1124834813 15:33186216-33186238 TTCCATTCATTTATTTTCATTGG + Intronic
1125145147 15:36458511-36458533 TGCCTTTGAGTCAGTTTGCTCGG + Intergenic
1126357823 15:47814790-47814812 TTCCAGTAAGTCAGACTCATTGG + Intergenic
1127284202 15:57518325-57518347 TTCCATTGAGTCAGTTTCATAGG + Intronic
1129718583 15:77865654-77865676 TTCCCTTGAGTGAGTTTCTAAGG + Intergenic
1133427101 16:5702170-5702192 TTTCATTGACTCAGTTCCACAGG + Intergenic
1133847587 16:9469701-9469723 TACCAGTGAGTCACTGTCATGGG + Intergenic
1140762309 16:78121038-78121060 TTACATTTAGTCATTTTCATGGG + Intronic
1141013162 16:80422315-80422337 TTTCTTTGATTCATTTTCATTGG + Intergenic
1141244588 16:82294117-82294139 TTCCTTTGAGTCTGGTTCTTAGG + Intergenic
1144373735 17:14618571-14618593 TTCCAATGACTCAGTCTCTTTGG + Intergenic
1144395603 17:14839715-14839737 TTTAATTGACTCAGTTTCACAGG - Intergenic
1147868954 17:43573856-43573878 TTGCATTGATTAAGTTTTATTGG - Intronic
1149722683 17:58862129-58862151 TTTCCTGGAGACAGTTTCATAGG + Intronic
1149904896 17:60516841-60516863 TTTCATTGAGTCACTGTGATGGG + Intronic
1150897529 17:69231021-69231043 TTCCATTGTATTAGTTTCCTAGG + Intronic
1153607134 18:6845968-6845990 TTCTACTGAGACAGATTCATTGG - Intronic
1153952981 18:10072502-10072524 TTCCAGTGTGTCTGTTTCATGGG + Intergenic
1154259144 18:12814398-12814420 TTGCATTGATTCTGTTTCCTGGG - Intronic
1156826150 18:41432134-41432156 TTTAATTGACTCAGTTTCATAGG + Intergenic
1156983996 18:43327256-43327278 TTCCACTGAGTCAGTGTAATAGG + Intergenic
1157660750 18:49441587-49441609 TTCCATTGCTTTCGTTTCATTGG - Intronic
1157798867 18:50602319-50602341 TTCTACTGGATCAGTTTCATAGG - Intronic
1158457393 18:57620293-57620315 CTCCATTGAGTCAGATTGCTGGG - Intronic
1160071582 18:75633655-75633677 TTCCAGAGAGTCACTTTCGTAGG + Intergenic
1161655423 19:5511448-5511470 TGCCATTGAATCACATTCATGGG + Intergenic
1163836775 19:19579746-19579768 TTCCATCCAGTCAGTTGCCTGGG - Intronic
925421319 2:3714646-3714668 ATCCTTTGAGTTAGATTCATTGG - Intronic
925835260 2:7938930-7938952 TTGCATTCTGTCAGTGTCATTGG + Intergenic
925873316 2:8289684-8289706 TTCCACTAAGTCAGTTTATTGGG + Intergenic
926501707 2:13662773-13662795 TTGCAGTGATTCTGTTTCATCGG + Intergenic
926821106 2:16852688-16852710 TCCCTTTGATTCAGTTTCATTGG + Intergenic
928377659 2:30788955-30788977 TTGAATATAGTCAGTTTCATAGG + Intronic
929284076 2:40115762-40115784 TTCCTCTGAGTCAGACTCATGGG + Intronic
930698451 2:54434849-54434871 TTCCATTGAGTATCTTTGATTGG + Intergenic
931678739 2:64724935-64724957 TTCCACTAAGTTACTTTCATAGG + Intronic
931845693 2:66201588-66201610 TACCTTTGAGCCAGTTTCTTGGG + Intergenic
936613277 2:114022876-114022898 TCCCATTGGCTCAGTTTCTTTGG + Intergenic
938834874 2:135091209-135091231 TTCCATAGTGTCAGTTTCTCTGG + Intronic
939223701 2:139337887-139337909 TGTCTTTGAGTCTGTTTCATAGG + Intergenic
941669390 2:168275392-168275414 TTCCATTGAGTCTGTTTCTCTGG + Intergenic
943055976 2:182980523-182980545 TTCCTTAGAGTCAGTTTATTTGG + Intronic
945926825 2:215814227-215814249 TTCCATGGGGACAGATTCATAGG - Intergenic
1168976111 20:1967080-1967102 TTCTATGCAGTCAGTTTCAAGGG + Intergenic
1169803576 20:9536245-9536267 TTCCCTTGAGTATGTTTGATGGG - Intergenic
1169921762 20:10741544-10741566 TTCCACTGTGTCAATATCATGGG - Intergenic
1170526178 20:17240183-17240205 TTGCATTTACTAAGTTTCATTGG + Intronic
1170935016 20:20802339-20802361 TCCTATTGAGTCTGTTTCTTTGG - Intergenic
1173442453 20:43090143-43090165 TTTCCTGGAGTCAGTTTTATGGG - Intronic
1174219284 20:48939770-48939792 TTCCAGTGAGTCAGTTTACTTGG + Intronic
1175312567 20:58021724-58021746 TTCCTTTGAGGCAGCTTCAGGGG + Intergenic
1175508878 20:59508032-59508054 TTCCATTGTGGCAGTGTCTTGGG - Intergenic
1175704239 20:61164213-61164235 CTCCATTTAGTCAGTTTGACCGG - Intergenic
1177397405 21:20555242-20555264 TTCCTCTGATTCAGTGTCATAGG + Intergenic
1177531066 21:22358876-22358898 TTAAATTGAGGCAGTTACATTGG + Intergenic
1184202169 22:42977880-42977902 TTTAATTGACTCAGTTTCACAGG - Intronic
950927125 3:16752362-16752384 TTCTTTTGAGTCAGTTTTGTTGG + Intergenic
952001998 3:28796801-28796823 ATCCATAGAGTCAGTCTCCTGGG + Intergenic
953728590 3:45424797-45424819 TTTCATTGTGACAGTTTCATAGG + Intronic
955500727 3:59580104-59580126 TGCCTTTGAGTCATTATCATGGG - Intergenic
956147677 3:66207438-66207460 TTCCAATGAGACAGTATTATGGG + Intronic
958862500 3:99461847-99461869 TTTAATTGACTCAGTTTCACAGG - Intergenic
959339317 3:105109005-105109027 TTCCAGTGATTCAGATGCATAGG - Intergenic
961246764 3:125460885-125460907 TTGCATAGAGTTACTTTCATTGG + Intronic
963094717 3:141523852-141523874 CTTCATTGAGTCATTTTCTTAGG + Intronic
964153943 3:153562679-153562701 TTCCCTTGAATCAAGTTCATTGG - Intergenic
964556285 3:157942977-157942999 TTCCTTTAAGTCAGATTCCTGGG - Intergenic
964769019 3:160204941-160204963 TTTAATTGACTCAGTTTCACAGG - Intergenic
965539681 3:169859633-169859655 CTCCATTAAGTTAGTTTCATAGG - Intronic
969730193 4:8950916-8950938 TTCCATTAAGTCAGTTTTCAGGG - Intergenic
969784691 4:9446044-9446066 TTCCATTTAGTGAGTATCAGTGG - Intronic
969789797 4:9485029-9485051 TTCCATTAAGTCAGTTTTCAGGG - Intergenic
970233201 4:13932308-13932330 TTCCATTGTATTAGTTTCCTAGG - Intergenic
970941068 4:21634294-21634316 TTCCATTGAATGAGATTCAGGGG - Intronic
973253152 4:48082473-48082495 TTCCATTGATTCAAGTTCTTTGG + Intronic
973310745 4:48707017-48707039 TTGCTGTGAGTCAGTTTCTTTGG - Intronic
973826631 4:54713900-54713922 TGTCACTGAGTCAGTTTAATAGG - Intronic
974468485 4:62288840-62288862 TTCCATTTGCTGAGTTTCATGGG + Intergenic
974738053 4:65965607-65965629 TACCAATGAGACACTTTCATGGG + Intergenic
979144149 4:117219929-117219951 TTCCATAAAGTCATTTTAATGGG + Intergenic
979369511 4:119867539-119867561 TTCCATGGAGACGGTTTCATAGG - Intergenic
979565529 4:122150707-122150729 TTCAATGGAGACAGTTTCTTTGG + Intergenic
981115138 4:140980770-140980792 TTTAATTGACTCAGTTCCATAGG - Intronic
982277638 4:153652542-153652564 TTCCATGAAGTCACTTCCATGGG - Intergenic
984836186 4:184023905-184023927 TTCCAGTGAGTCACTTGCACAGG + Intergenic
984937722 4:184903966-184903988 TTCCATTCAGTCTGTTTCCCAGG - Intergenic
985272794 4:188209959-188209981 TTCCTTTCAGTCAGTCTCACAGG + Intergenic
987694865 5:21315211-21315233 TTCAATTTTGTCAGTTCCATAGG - Intergenic
988626685 5:32884127-32884149 TTTTATGGAGTAAGTTTCATAGG + Intergenic
988719993 5:33868111-33868133 TTTAATTGACTCAGTTCCATAGG - Intronic
988774147 5:34461777-34461799 TTCCATAGCGATAGTTTCATGGG + Intergenic
990939765 5:61189597-61189619 TTTCATTGACTCAGTTCCACAGG - Intergenic
991745366 5:69734230-69734252 TTCAATTTTGTCAGTTCCATAGG + Intergenic
991752341 5:69820996-69821018 TTCAATTTTGTCAGTTCCATAGG - Intergenic
991796934 5:70313959-70313981 TTCAATTTTGTCAGTTCCATAGG + Intergenic
991824743 5:70609544-70609566 TTCAATTTTGTCAGTTCCATAGG + Intergenic
991831659 5:70696120-70696142 TTCAATTTTGTCAGTTCCATAGG - Intergenic
991889312 5:71313515-71313537 TTCAATTTTGTCAGTTCCATAGG + Intergenic
995924148 5:117349444-117349466 TGCCATTGAGTGAATTTTATAGG + Intergenic
998748917 5:145295422-145295444 TTCCAATGAGTCAGTGTAAAGGG - Intergenic
999161487 5:149503660-149503682 ATCCACTGAGTTAGTTTCATTGG - Intronic
1000116488 5:158158825-158158847 TTCCATTGATTCTGTTTCTGTGG - Intergenic
1000848129 5:166306508-166306530 TTACATTGTGTGAGTTTTATGGG + Intergenic
1002176192 5:177402833-177402855 TGCCATTAATTCAATTTCATAGG + Intronic
1004417815 6:15440606-15440628 TTCCATTGGCACAGTTTCTTTGG + Intronic
1005438609 6:25840801-25840823 TTCCTTTGGGTAAGTTTCTTAGG - Intronic
1005556035 6:26984719-26984741 TTCAATTTTGTCAGTTCCATAGG + Intergenic
1005713257 6:28522835-28522857 TTCCATTGTTTCAGTTTCCCTGG - Intronic
1006399530 6:33808761-33808783 TTGCACTGAGTCTGTATCATGGG - Intergenic
1007512351 6:42383372-42383394 TTGCATTTAGGCAGCTTCATAGG - Intronic
1007969009 6:46032093-46032115 TTTAATTGACTCAGTTCCATAGG + Intronic
1011249222 6:85353406-85353428 TTCTAATGAGTCAGGTTCACAGG - Intergenic
1011919827 6:92559688-92559710 TTTCATTGACTCAGTTTCGCAGG + Intergenic
1011921702 6:92585668-92585690 TTTCATTGTGTCAGTTCTATTGG + Intergenic
1011954643 6:93011592-93011614 TTCCATTGGGTAAGTTCCATTGG + Intergenic
1014768038 6:125429702-125429724 TTCATTTGAGTCACTTTCCTTGG + Intergenic
1015667232 6:135645417-135645439 TTCTATTGTGTCTGTTTCTTTGG + Intergenic
1016159940 6:140866576-140866598 TCCCATTGTGTCAGTGACATAGG - Intergenic
1017690621 6:156960577-156960599 TTCCTTTGAGTCAGTTTTCATGG + Intronic
1017773174 6:157659015-157659037 TTCCCTTGGGTCAGTCTCAGTGG + Intronic
1021879949 7:25085188-25085210 TTCAATTGATTCTGTTTCTTTGG + Intergenic
1022766448 7:33417780-33417802 TTCCATTCAGCCAAGTTCATTGG + Intronic
1023667821 7:42542987-42543009 TTCCATTCAGTCAGTTCTAGGGG + Intergenic
1024499323 7:50086352-50086374 TTCCTTGGAGTCTGTTTCAGTGG - Intronic
1028440000 7:90848824-90848846 TTCCATCTAGTGGGTTTCATTGG + Intronic
1031722639 7:125195225-125195247 TTTCATTGAGTCATTTTTGTTGG + Intergenic
1032303619 7:130712515-130712537 CTCCATTGACTCAGTTTGAGTGG + Intergenic
1033400279 7:141016320-141016342 TTTTATTAAGTCAATTTCATGGG + Intergenic
1036834344 8:12048092-12048114 TTCCATTTAGTGAGTATCAGTGG + Intergenic
1036960905 8:13243435-13243457 TTTAATTGACTCAGTTTCACAGG - Intronic
1037438020 8:18884835-18884857 TACCATTCAGTCAATTTCAGAGG + Intronic
1045763627 8:105641124-105641146 TTACATTGTGTCAGTTTGTTTGG - Intronic
1045784054 8:105901063-105901085 TACCATTTACTCAGTTTCACAGG + Intergenic
1046265917 8:111830063-111830085 TTCCTTTGAGTCACTACCATAGG - Intergenic
1047923498 8:129658754-129658776 TTTAATTGACTCAGTTTTATAGG + Intergenic
1048358592 8:133674832-133674854 TTCTATTGAGTCACTGTCATTGG + Intergenic
1050192862 9:3046721-3046743 TTACATTGCCTCTGTTTCATGGG - Intergenic
1050213200 9:3288628-3288650 TTCCATTGACTAATTTTTATTGG - Intronic
1050729770 9:8695558-8695580 TTCCAAGGAGTCATTCTCATTGG + Intronic
1051971838 9:22897814-22897836 TCCCCTTGAATCTGTTTCATTGG + Intergenic
1056784154 9:89576895-89576917 CTGTATTGAGTCAGTTTTATTGG + Intergenic
1059569144 9:115415646-115415668 TTCCTTTTGGTCAGTTTCACTGG + Intergenic
1060165567 9:121411522-121411544 TCCTATTGACTCTGTTTCATTGG + Intergenic
1061311606 9:129767049-129767071 GTCTTTTGGGTCAGTTTCATTGG - Intergenic
1061456770 9:130704116-130704138 TTCTATTGGGGCAATTTCATGGG - Exonic
1186010936 X:5132057-5132079 TTCCATTGATTTAGTCTCAATGG + Intergenic
1192596505 X:72413813-72413835 TTTCATTGACTCAGTTCCACAGG - Intronic
1195109682 X:101634625-101634647 TTCTATTGAGTTAATATCATTGG + Intergenic
1197032474 X:121834210-121834232 TTCAAACTAGTCAGTTTCATAGG - Intergenic
1197118906 X:122867037-122867059 TTCCTTTCACTCAGTTTTATTGG - Intergenic
1197463414 X:126771603-126771625 TTCAATTGAGTTACTTTCCTAGG - Intergenic
1198029903 X:132744814-132744836 TTCCATTCATTCATTTTCTTTGG - Intronic
1198217496 X:134569319-134569341 TTGCACTGAGTCAGTCTCAAAGG + Intronic
1199286427 X:146059579-146059601 TTCCATTTAGATTGTTTCATTGG - Intergenic
1199619244 X:149684865-149684887 TTTAATTGACTCAGTTTCACAGG - Intergenic
1201668621 Y:16489853-16489875 TTCCATTGACTCAGTCTCAATGG - Intergenic