ID: 1127290402 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:57565434-57565456 |
| Sequence | CTGTTTGCTCACATCGCGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127290399_1127290402 | 5 | Left | 1127290399 | 15:57565406-57565428 | CCTGGCATGAGATGGCGTTTTCT | No data | ||
| Right | 1127290402 | 15:57565434-57565456 | CTGTTTGCTCACATCGCGGAGGG | No data | ||||
| 1127290397_1127290402 | 20 | Left | 1127290397 | 15:57565391-57565413 | CCTATTTGAAAGGATCCTGGCAT | No data | ||
| Right | 1127290402 | 15:57565434-57565456 | CTGTTTGCTCACATCGCGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127290402 | Original CRISPR | CTGTTTGCTCACATCGCGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||