ID: 1127290402

View in Genome Browser
Species Human (GRCh38)
Location 15:57565434-57565456
Sequence CTGTTTGCTCACATCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127290399_1127290402 5 Left 1127290399 15:57565406-57565428 CCTGGCATGAGATGGCGTTTTCT No data
Right 1127290402 15:57565434-57565456 CTGTTTGCTCACATCGCGGAGGG No data
1127290397_1127290402 20 Left 1127290397 15:57565391-57565413 CCTATTTGAAAGGATCCTGGCAT No data
Right 1127290402 15:57565434-57565456 CTGTTTGCTCACATCGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127290402 Original CRISPR CTGTTTGCTCACATCGCGGA GGG Intergenic
No off target data available for this crispr