ID: 1127292659

View in Genome Browser
Species Human (GRCh38)
Location 15:57584066-57584088
Sequence TCAGGCAGGGTTTCTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127292659_1127292665 16 Left 1127292659 15:57584066-57584088 CCACAAGCAGAAACCCTGCCTGA No data
Right 1127292665 15:57584105-57584127 TCAGAAAGACCCCTGTCAGCTGG No data
1127292659_1127292668 23 Left 1127292659 15:57584066-57584088 CCACAAGCAGAAACCCTGCCTGA No data
Right 1127292668 15:57584112-57584134 GACCCCTGTCAGCTGGAGTGGGG No data
1127292659_1127292667 22 Left 1127292659 15:57584066-57584088 CCACAAGCAGAAACCCTGCCTGA No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292659_1127292666 21 Left 1127292659 15:57584066-57584088 CCACAAGCAGAAACCCTGCCTGA No data
Right 1127292666 15:57584110-57584132 AAGACCCCTGTCAGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127292659 Original CRISPR TCAGGCAGGGTTTCTGCTTG TGG (reversed) Intergenic