ID: 1127292661

View in Genome Browser
Species Human (GRCh38)
Location 15:57584079-57584101
Sequence GCCAGTAGTGGCTTCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127292661_1127292665 3 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292665 15:57584105-57584127 TCAGAAAGACCCCTGTCAGCTGG No data
1127292661_1127292672 27 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292661_1127292666 8 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292666 15:57584110-57584132 AAGACCCCTGTCAGCTGGAGTGG No data
1127292661_1127292667 9 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292661_1127292668 10 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292668 15:57584112-57584134 GACCCCTGTCAGCTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127292661 Original CRISPR GCCAGTAGTGGCTTCAGGCA GGG (reversed) Intergenic