ID: 1127292664

View in Genome Browser
Species Human (GRCh38)
Location 15:57584091-57584113
Sequence TCTTTCTGATATGCCAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127292664_1127292672 15 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292664_1127292667 -3 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292664_1127292666 -4 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292666 15:57584110-57584132 AAGACCCCTGTCAGCTGGAGTGG No data
1127292664_1127292665 -9 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292665 15:57584105-57584127 TCAGAAAGACCCCTGTCAGCTGG No data
1127292664_1127292668 -2 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292668 15:57584112-57584134 GACCCCTGTCAGCTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127292664 Original CRISPR TCTTTCTGATATGCCAGTAG TGG (reversed) Intergenic