ID: 1127292667

View in Genome Browser
Species Human (GRCh38)
Location 15:57584111-57584133
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127292662_1127292667 8 Left 1127292662 15:57584080-57584102 CCTGCCTGAAGCCACTACTGGCA No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292663_1127292667 4 Left 1127292663 15:57584084-57584106 CCTGAAGCCACTACTGGCATATC No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292659_1127292667 22 Left 1127292659 15:57584066-57584088 CCACAAGCAGAAACCCTGCCTGA No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292661_1127292667 9 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data
1127292664_1127292667 -3 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127292667 Original CRISPR AGACCCCTGTCAGCTGGAGT GGG Intergenic
No off target data available for this crispr