ID: 1127292672

View in Genome Browser
Species Human (GRCh38)
Location 15:57584129-57584151
Sequence GTGGGGCCAGATAGCAACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127292662_1127292672 26 Left 1127292662 15:57584080-57584102 CCTGCCTGAAGCCACTACTGGCA No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292664_1127292672 15 Left 1127292664 15:57584091-57584113 CCACTACTGGCATATCAGAAAGA No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292661_1127292672 27 Left 1127292661 15:57584079-57584101 CCCTGCCTGAAGCCACTACTGGC No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292671_1127292672 -10 Left 1127292671 15:57584116-57584138 CCTGTCAGCTGGAGTGGGGCCAG No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292669_1127292672 -8 Left 1127292669 15:57584114-57584136 CCCCTGTCAGCTGGAGTGGGGCC No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292663_1127292672 22 Left 1127292663 15:57584084-57584106 CCTGAAGCCACTACTGGCATATC No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data
1127292670_1127292672 -9 Left 1127292670 15:57584115-57584137 CCCTGTCAGCTGGAGTGGGGCCA No data
Right 1127292672 15:57584129-57584151 GTGGGGCCAGATAGCAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127292672 Original CRISPR GTGGGGCCAGATAGCAACTT AGG Intergenic