ID: 1127293731

View in Genome Browser
Species Human (GRCh38)
Location 15:57592060-57592082
Sequence GGCGGCGCCGCCCGAGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127293731_1127293739 1 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293739 15:57592084-57592106 GGACGCCCGGGGCGCCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 218
1127293731_1127293750 21 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293750 15:57592104-57592126 AGGAGGGTGAGTAGCGGGGGCGG 0: 1
1: 0
2: 2
3: 53
4: 679
1127293731_1127293748 17 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293748 15:57592100-57592122 CAGCAGGAGGGTGAGTAGCGGGG 0: 1
1: 1
2: 1
3: 22
4: 280
1127293731_1127293741 5 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293741 15:57592088-57592110 GCCCGGGGCGCCCAGCAGGAGGG 0: 1
1: 0
2: 0
3: 48
4: 269
1127293731_1127293736 -10 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293736 15:57592073-57592095 CGGCGCCGCCAGGACGCCCGGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1127293731_1127293751 22 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293751 15:57592105-57592127 GGAGGGTGAGTAGCGGGGGCGGG 0: 1
1: 0
2: 4
3: 49
4: 636
1127293731_1127293745 15 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293745 15:57592098-57592120 CCCAGCAGGAGGGTGAGTAGCGG 0: 1
1: 0
2: 3
3: 35
4: 352
1127293731_1127293747 16 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293747 15:57592099-57592121 CCAGCAGGAGGGTGAGTAGCGGG 0: 1
1: 0
2: 3
3: 31
4: 353
1127293731_1127293749 18 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293749 15:57592101-57592123 AGCAGGAGGGTGAGTAGCGGGGG 0: 1
1: 0
2: 2
3: 25
4: 349
1127293731_1127293740 4 Left 1127293731 15:57592060-57592082 CCCTGCTCTCGGGCGGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1127293740 15:57592087-57592109 CGCCCGGGGCGCCCAGCAGGAGG 0: 1
1: 0
2: 2
3: 23
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127293731 Original CRISPR GGCGGCGCCGCCCGAGAGCA GGG (reversed) Exonic
900140310 1:1137024-1137046 CGCGGCGCCCACCGAGAGCTGGG + Intergenic
901109840 1:6785654-6785676 GGCGGCGCCGGGCGGGAGCGCGG + Intronic
901124627 1:6920354-6920376 GGCGGAGCTGCCCAAGACCATGG - Intronic
901242713 1:7704464-7704486 GGCGTCCCCGCGCGAGAGCCGGG - Intronic
902925881 1:19695388-19695410 GGCGGCAAGGCCCGAGGGCATGG - Intronic
903263410 1:22143098-22143120 GTCAGCGCCGCCCCAGAGCCGGG + Intronic
903652727 1:24931263-24931285 TGCGGCGCAGCCGGAGCGCACGG - Intronic
905375108 1:37514707-37514729 GGCGGCGCCGCCGCAGATCCCGG - Exonic
906038263 1:42766663-42766685 GGCGGCGGCGCCCGAGGCCTGGG + Exonic
906299927 1:44674395-44674417 GAAGGCGCCGGCCCAGAGCACGG + Exonic
906463844 1:46058524-46058546 GGCGGAGCTGCCCCAGACCATGG + Intronic
906763928 1:48409338-48409360 GGCGGAGCTGCCCAAGACCATGG - Intronic
907440363 1:54474922-54474944 GGCAGCCCCGCCCGGGCGCAGGG + Intergenic
907984238 1:59515123-59515145 GGCAGCGCTGCCCAAGACCATGG + Intronic
909439774 1:75684686-75684708 GGCGGAGCTGCCCAAGACCATGG - Intergenic
910258773 1:85276385-85276407 GGCGGCGCAGCCCGAGCTCCCGG - Exonic
911985423 1:104616491-104616513 GGCGGAGCTGCCCAAGACCATGG - Intergenic
912165730 1:107040213-107040235 GGCTGAGCTGCCCAAGAGCATGG + Intergenic
922950904 1:229558220-229558242 GGCGGCGCCTCCCGGGGACAAGG - Exonic
1065023201 10:21517337-21517359 GGCGGCGGCGCCCGGGCGCTGGG + Exonic
1065240159 10:23695911-23695933 GGCGACAGCGCCCGGGAGCAGGG + Intronic
1068439495 10:57032667-57032689 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1069604712 10:69731961-69731983 TGCGGCCCTGCCCCAGAGCATGG - Intergenic
1070112092 10:73495964-73495986 GGCGGCGCCGCCGGGGAACATGG + Exonic
1070609967 10:77926517-77926539 GGCGGCGCGGCCCGCCACCATGG - Exonic
1075354199 10:121756259-121756281 GGCGGAGCTGCCCAAGACCATGG - Intronic
1076926751 10:133494553-133494575 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1077324258 11:1956958-1956980 GGCGGCGCCGGGTGAGAGAACGG + Intronic
1078365085 11:10699873-10699895 GGTGGAGCTGCCCAAGAGCATGG + Intergenic
1079451288 11:20601628-20601650 GGCCACGCTGCCCGGGAGCACGG - Exonic
1080183074 11:29446785-29446807 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1081400428 11:42636355-42636377 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1081812911 11:45923201-45923223 GGGGGCGCCGCCCCCGAGCCCGG + Intronic
1081873195 11:46392325-46392347 GGCCGGGCCGCCCGCGAGGAGGG + Intergenic
1082854136 11:57791446-57791468 GGCGGAGCCGCCGCAGGGCAGGG - Exonic
1084880789 11:72170067-72170089 GGCGGAGCTGCCAGAGACCATGG + Intergenic
1085593893 11:77790831-77790853 GGCGGAGCTGCCCAAGACCATGG - Intronic
1085941763 11:81213788-81213810 GGTGGCGCTGCCCAAGACCATGG - Intergenic
1086231780 11:84578414-84578436 GGCAGAGCTGCCCAAGAGCATGG + Intronic
1086993425 11:93330586-93330608 GGCGGCGCCGCGCGCGGGGAGGG + Intronic
1087114696 11:94512643-94512665 GGCCGCGGCCCCCTAGAGCACGG + Intergenic
1087438364 11:98151462-98151484 GGCGGAGCTGCCCAAGAACATGG + Intergenic
1087474672 11:98620769-98620791 GGCGGAGCTGCCCGAGACCATGG + Intergenic
1087763730 11:102127819-102127841 GGCGGAGCTGCCCAAGACCATGG + Intronic
1088143633 11:106649000-106649022 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1089149396 11:116353128-116353150 GCAGGCTCTGCCCGAGAGCAAGG + Intergenic
1089731105 11:120519504-120519526 GGCGGGGAAGCCCGAGATCAAGG - Intronic
1090003958 11:122984210-122984232 GGCTTCTCCGCCTGAGAGCAGGG - Intergenic
1090375136 11:126283059-126283081 GGCGGCGCTTCCGGAGAGCGGGG + Intronic
1202807244 11_KI270721v1_random:12153-12175 GGCGGCGCCGGGTGAGAGAACGG + Intergenic
1092228905 12:6766310-6766332 GGCGGCGCTGCCCGACGGGAGGG - Intronic
1094706117 12:32915865-32915887 GGCGGAGCTGCCCAAGACCACGG + Intergenic
1094786837 12:33858925-33858947 GGCAGAGCTGCCCGAGACCATGG - Intergenic
1095235075 12:39785726-39785748 GGCGGAGCTGCCCAAGACCATGG + Intronic
1095623274 12:44283392-44283414 GGCGGAGCTGCCCAAGACCATGG + Intronic
1096396506 12:51270217-51270239 GGCGGGGGCGCCGGAGAGCCGGG - Intronic
1097732844 12:63150065-63150087 GACGGCGTCGCGCCAGAGCAAGG - Exonic
1098426085 12:70366614-70366636 GCCGCCGCCGCGCGACAGCAGGG - Exonic
1104049489 12:125186269-125186291 GGAGGGGCCGCCCGGGAGCCGGG - Intergenic
1106304058 13:28494913-28494935 GGCGGCGGCGAACGAGAGGACGG - Exonic
1108689240 13:52847206-52847228 GGGGGCGGCGCGCGAGAGCCTGG - Exonic
1109097952 13:58142178-58142200 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1111715803 13:91877386-91877408 GGCAGAGCTGCCCAAGAGCATGG + Intronic
1112652639 13:101416098-101416120 GGCGCCTCCACCCGAGAGCGGGG - Intronic
1112882411 13:104123662-104123684 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1113838206 13:113343405-113343427 GACGGAGCCGCCCCAGAGGAAGG - Intronic
1115120054 14:29927850-29927872 GTCGGCGCGGCCCGAGCGCCGGG + Intronic
1116080315 14:40162838-40162860 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1116564842 14:46432150-46432172 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1117176683 14:53153019-53153041 GGCGGCGGCGCCTGGGAGCTGGG - Exonic
1117427853 14:55620199-55620221 GGCGGAGCTGCCCAAGACCATGG - Intronic
1118186644 14:63543577-63543599 GGCTGCACCGCCCGAGATCGCGG - Intergenic
1119216272 14:72871600-72871622 GGCGGAGCTGCCCAAGACCATGG - Intronic
1119385979 14:74258416-74258438 GGCGGCGCCGGCCCAGACCCAGG + Intronic
1122436808 14:101706271-101706293 GGCGGCGCCGCCCCGGAGGCAGG + Intergenic
1122691258 14:103533100-103533122 GGCAGCGCCACCCAAGTGCAGGG + Intronic
1122779907 14:104139160-104139182 GCCGGGGCCGGCCCAGAGCAGGG + Exonic
1122942039 14:104985841-104985863 GGCGGGGCCGCGCGGGACCAGGG - Exonic
1124691340 15:31825953-31825975 GGCGGAGCTGCCCAAGACCATGG - Intronic
1125508792 15:40282044-40282066 GGCGGCGCGGCCCCAGGGCCCGG + Exonic
1126786200 15:52179636-52179658 CGCGCCACCGCCCGGGAGCAGGG - Intronic
1127164645 15:56231999-56232021 GGCGGAGCCGCTCAAGACCATGG - Intronic
1127293731 15:57592060-57592082 GGCGGCGCCGCCCGAGAGCAGGG - Exonic
1128303408 15:66581569-66581591 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1130520558 15:84658078-84658100 GGCGACGCCGGCAGCGAGCAGGG + Exonic
1131556565 15:93404651-93404673 GGCGGAGCTGCCCAAGACCACGG + Intergenic
1132579732 16:679484-679506 GGCGGCCCGCCCCGAGGGCAGGG - Intronic
1132915506 16:2341442-2341464 GGCGGGGCCGCCTGTGAGGAGGG + Intergenic
1133794227 16:9033282-9033304 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1139475072 16:67199052-67199074 GGCGGCCCCGCCCCACACCAAGG - Intergenic
1139575995 16:67842446-67842468 GGCGGCGCCGCGCGAGGCCTTGG - Exonic
1142620221 17:1160931-1160953 GGTGGCGGGGCCAGAGAGCAAGG - Intronic
1143719400 17:8799243-8799265 CGCGGCGCCGCCCCAGACCGGGG - Exonic
1144786863 17:17836894-17836916 GGCGGCGGCGACTGAGAGCCGGG - Exonic
1147315517 17:39618246-39618268 GGCGGCCCCGCCCGGGAGCATGG - Intergenic
1147994601 17:44353927-44353949 GGTGGCGGCGCCCGAGGGCCGGG - Exonic
1147994752 17:44354509-44354531 GCCGGCCCCGCCGGAGGGCACGG - Exonic
1149902424 17:60492502-60492524 GGCGGAGCTGCCCAAGACCATGG + Intronic
1152361378 17:79834657-79834679 GGAGGCGCCGCCCAAGAGGAGGG - Exonic
1152480111 17:80545255-80545277 GGCGGTGGAGGCCGAGAGCAGGG + Exonic
1152730428 17:81967213-81967235 GGCGGTGCCGTCGCAGAGCATGG + Intergenic
1152970703 18:158659-158681 GGCGGCGGCGCAGGAGAGCTGGG - Exonic
1155851750 18:30782957-30782979 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1158137684 18:54224456-54224478 GGCGACTCCGCCATAGAGCAGGG - Exonic
1159962351 18:74565654-74565676 GGCAGAGCCACCCGAGACCATGG - Intronic
1160701053 19:507590-507612 GGCGGGGGCGGCCGAGAGCGAGG + Exonic
1161052873 19:2174200-2174222 GACGGTGCTGCCCGAGAGCCAGG - Intronic
1161072884 19:2271148-2271170 GGCGGCGCCGCCCGAGGAGTCGG + Intronic
1161194220 19:2977372-2977394 GGCGGCGCCGGCCAATAGCGAGG - Intergenic
1161703242 19:5805934-5805956 GGCGGCGGCGGCGGCGAGCAGGG - Intergenic
1162733774 19:12734537-12734559 GGGGACGTCGCCCGAGAGCGGGG - Exonic
1162809123 19:13153768-13153790 GACGGCGCCGCCCGCGTGCGAGG + Exonic
1164624054 19:29715064-29715086 GGCCGCGCCCCGCGAGAGGAGGG - Intronic
1165520290 19:36309418-36309440 GGCGGCGCAGCCCGAGGCGACGG - Intergenic
1166638071 19:44469513-44469535 GGCGGAGCCGCCCAAGACCATGG - Intergenic
1166748555 19:45153737-45153759 GGCCGCGCAGCGCGAGAGCGAGG - Exonic
1167110355 19:47457114-47457136 GGCGGCGCCGGCCGAGGGCGCGG - Exonic
1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG + Intergenic
1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG + Intronic
1167465024 19:49646135-49646157 GGCGGCGCTGCCGGAGTCCACGG + Exonic
926914579 2:17879404-17879426 CGCAGCGCTGCACGAGAGCAAGG - Intronic
927605688 2:24484269-24484291 GGCGGAGCTGCCCAAGACCATGG + Intergenic
927931783 2:27050153-27050175 GGCGGCGTGGCCCGAGGGCTCGG - Intronic
928983213 2:37156898-37156920 GGCGGCGGCGCAGGTGAGCAGGG - Exonic
932904344 2:75733559-75733581 GGCGGGGCTGCCCAAGACCATGG - Intergenic
937905377 2:127050388-127050410 GGTGGGGCCGCCAGAGCGCAGGG - Intronic
938322080 2:130372395-130372417 GGAGGCGCCGCTCTACAGCAAGG + Exonic
940646786 2:156400309-156400331 CGCGGCGCGGCCCGAGCGCTGGG + Intergenic
940712211 2:157176215-157176237 GGCGGAGCTGCCCAAGACCATGG + Intergenic
941384943 2:164841395-164841417 GGCGGCGGCGCCCGCGGGCTGGG - Exonic
942314194 2:174682930-174682952 GGCGGCGGCGCCGGAGGGGAGGG - Intergenic
942799611 2:179860982-179861004 GGGCGCGCCGCCCGAGGGAATGG - Intronic
943245931 2:185451023-185451045 GGCGGAGCTGCCCAAGACCATGG - Intergenic
947518811 2:230828684-230828706 GGCGGCGGCGCCCCAGGGCTGGG + Intergenic
947888608 2:233595957-233595979 GGCGGAGCTGCCCAAGACCATGG + Intergenic
948140600 2:235669908-235669930 CGCCGCGCCGCCCGAGTGCCGGG - Intronic
948315688 2:237026852-237026874 TGCCGAGCGGCCCGAGAGCAGGG + Intergenic
1169438029 20:5610875-5610897 CGCCGCCCCGCCCGAGAGCGAGG + Exonic
1170889923 20:20368245-20368267 GTTGGCGCGGCCCGAGGGCACGG - Exonic
1171457291 20:25279168-25279190 GGCGGCACCTCCCCAGAGCCTGG + Intronic
1172604715 20:36206788-36206810 GCCAGCGCAGCCCGAGAGGAAGG + Intronic
1173606776 20:44337253-44337275 CCCGGCCCAGCCCGAGAGCACGG + Exonic
1174066292 20:47868071-47868093 GGAGGCCCCGCAGGAGAGCAGGG + Intergenic
1174157786 20:48528032-48528054 GGAGGAGCCGCAGGAGAGCAGGG - Intergenic
1174661898 20:52220851-52220873 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1177839346 21:26218604-26218626 GGCGGAGCTGCCCAAGATCATGG + Intergenic
1180080966 21:45487360-45487382 GGTGGCACTGCCCGAGAGGAGGG - Intronic
1180972922 22:19824935-19824957 GGCTGTGCAGCCCGAGGGCAGGG - Intronic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1184087517 22:42274086-42274108 GGCGGCGCCTCCCAAGAGGAAGG - Intronic
1184311994 22:43651718-43651740 GGCGGAGCTGCCCAAGACCATGG + Intronic
1184473156 22:44707221-44707243 GGCCCCGCAGCCCAAGAGCACGG - Intronic
1184507622 22:44913917-44913939 GCAGACGCAGCCCGAGAGCACGG - Exonic
951865190 3:27299687-27299709 GGCGGAGCTGCCCAAGATCATGG + Intronic
953404823 3:42654960-42654982 GGCGGCGCCGTCCGGGCGCAGGG - Intronic
954558828 3:51538936-51538958 GGCGGCCCCGGCCGGGAGCGAGG - Intergenic
954591629 3:51788255-51788277 GGCGGAGCTGCCCAAGACCATGG + Intergenic
956892206 3:73624102-73624124 GGCCGCGCCGCCCGGCGGCAAGG - Exonic
957260571 3:77896825-77896847 GGCAGAGCCGCCCAAGACCATGG - Intergenic
957621111 3:82594582-82594604 GGCGGAGCTGCCCAAGACCATGG - Intergenic
959054512 3:101554099-101554121 GGCGGAGCTGCCCAAGACCATGG + Intergenic
959512940 3:107234106-107234128 GGCGGAGCTGCCCAAGACCATGG + Intergenic
961257845 3:125572050-125572072 GGCGGAGCTGCCCAAGACCATGG + Intronic
961474020 3:127135897-127135919 GGCAGGGCCGCCCGAGTGCAGGG - Intergenic
964520629 3:157563140-157563162 GGCGGAGCTGCCCAAGACCATGG - Intronic
965915625 3:173842693-173842715 GGCGGAGCTGCCCAAGACCATGG - Intronic
965962088 3:174441077-174441099 GGCCGCGCCGCCTCAGAGCGCGG - Intronic
966314751 3:178633073-178633095 GGCGGAGCTGCCCAAGACCATGG - Intronic
968174020 3:196533530-196533552 GGGGGCGCCGCAGGAGAGCAGGG + Intergenic
968265623 3:197360782-197360804 GGCGGAGCTGCCCAAGACCATGG + Intergenic
968450742 4:674899-674921 GGCTGCTCTGCCCGGGAGCACGG + Intronic
968583195 4:1404339-1404361 GCCGGAGCCGGCCGAGAGAATGG + Intronic
970574646 4:17414789-17414811 GGAGGCGCCGACAGGGAGCAAGG + Intergenic
971570403 4:28204559-28204581 GGTGGAGCTGCCCAAGAGCATGG - Intergenic
979097803 4:116573375-116573397 GGCAGAGCTGCCCAAGAGCAGGG - Intergenic
980053721 4:128061264-128061286 AGAGGGGCGGCCCGAGAGCACGG - Exonic
981120937 4:141050694-141050716 GGCGGAGCTGCCCAAGACCATGG - Intronic
982236648 4:153257251-153257273 AGCGGCCCAGCACGAGAGCATGG + Intronic
985201484 4:187489193-187489215 GGCGGAGCTGCCCAAGATCATGG + Intergenic
986113873 5:4750290-4750312 GGCGGAGCTGCCCAAGACCATGG - Intergenic
986397287 5:7343475-7343497 GGCGGAGCTGCCCAAGACCATGG + Intergenic
986756695 5:10843631-10843653 GGCGGAGCTGCCCAAGACCATGG - Intergenic
987102510 5:14604815-14604837 GGCGGAGCTGCCCAAGACCATGG - Intronic
987379925 5:17275594-17275616 CGCGGCCCCGGCCGAGAGCGCGG + Exonic
987433607 5:17865724-17865746 GGCAGAGCCGCCCAAGACCATGG + Intergenic
990075685 5:51843585-51843607 GGCGGAGCTGCCCAAGAACATGG - Intergenic
990526133 5:56629352-56629374 GGCGGAGCTGCCCAAGACCATGG + Intergenic
990789047 5:59455765-59455787 GGTGGAGCCGCCCAAGACCATGG + Intronic
993502082 5:88675885-88675907 GCCGGCGGAGCCCGAGAGCGCGG - Intergenic
994524262 5:100883170-100883192 GGCGGAGCTGCCCAAGACCATGG + Intronic
995518497 5:112977127-112977149 GGCGGTGTCGTCGGAGAGCAGGG - Intronic
996196404 5:120611968-120611990 GGCGGAGCTGCCCAAGACCATGG + Intronic
996897703 5:128504457-128504479 GGCGGAGCTGCCCAAGACCATGG + Intronic
997470503 5:134114675-134114697 GGCGCCGCCGGCCGAGTGCCGGG - Intergenic
998576604 5:143323974-143323996 GGCGGAGCTGCCCAAGACCATGG - Intronic
999322654 5:150624863-150624885 GGCGGCGGCGCCCGGGAGCTCGG + Intronic
999768110 5:154755844-154755866 GCCGCCGGCGCCCGAGGGCAAGG + Intronic
999782047 5:154857794-154857816 GACGGCGCCTCCCGTGGGCACGG - Intronic
1001361576 5:171091183-171091205 GGTGGAGCTGCCCGAGACCATGG + Intronic
1003425556 6:5996233-5996255 GACGGGGCCGCCCTAGAGGAAGG - Intergenic
1006122478 6:31815727-31815749 AGCGGAGCCGACAGAGAGCAGGG + Exonic
1006221498 6:32495658-32495680 GGAGGCGCCGCGAGTGAGCAAGG + Intergenic
1006814262 6:36839864-36839886 GGCGGCGCAGCCCGGGCGCTCGG - Exonic
1009664391 6:66655869-66655891 GGAGGCGCCGAGAGAGAGCAAGG + Intergenic
1009723417 6:67506033-67506055 GGAGGAGCTGCCCAAGAGCATGG - Intergenic
1009980392 6:70720319-70720341 GGCAGAGCCGCCCAAGACCATGG - Intronic
1010107086 6:72182674-72182696 CGCGGCGCTGCCGGAGGGCAAGG + Exonic
1010735802 6:79442823-79442845 GGCTGAGCTGCCCAAGAGCATGG - Intergenic
1012475686 6:99613419-99613441 AGCGGAGCCGCCCGAGGACAAGG + Exonic
1012939672 6:105403222-105403244 GCCCGCGCCGCCCGGGCGCACGG + Intergenic
1013918216 6:115367122-115367144 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1014137732 6:117907906-117907928 GGCGGCGCCGGGCGAGGGCGCGG + Intronic
1017710917 6:157167136-157167158 GCAGGCGCCGCCCTACAGCATGG + Exonic
1018400488 6:163415134-163415156 GCCGCCGCCGCCGGAGAGGAGGG - Exonic
1018670102 6:166169887-166169909 CGCGACGCCGTCCGAGCGCAGGG - Intergenic
1019092767 6:169553236-169553258 GTCGGCGGCTCCCTAGAGCAGGG - Intronic
1019163713 6:170085644-170085666 GGCGGAGCTGCCCGAGTGCTGGG + Intergenic
1019492525 7:1321972-1321994 GGTGGGGCGGCCCCAGAGCAGGG + Intergenic
1020009307 7:4799710-4799732 TGCGGGGCTGCCCGGGAGCAGGG + Exonic
1022113038 7:27243135-27243157 GCCGGAGCCGCCCGAGAAAATGG + Exonic
1022909092 7:34882870-34882892 GGCTGAGCTGCCCGAGACCAGGG - Intergenic
1024021377 7:45373861-45373883 GGTGGGGCTGCCCGAGACCATGG - Intergenic
1024424700 7:49212309-49212331 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1027624818 7:80532410-80532432 GGCAGAGCTGCCCAAGAGCATGG + Intronic
1029371743 7:100154930-100154952 GGAGGCACAGCCCGGGAGCAGGG + Exonic
1029735744 7:102464951-102464973 GGCGGCGCCGCGCGAGCCCGTGG - Exonic
1029987757 7:104937174-104937196 GGCAGCGCAGCCTTAGAGCAAGG - Intergenic
1031532007 7:122886685-122886707 GGCGGAGCCGCCCGAGCGCCCGG + Intronic
1031895951 7:127347908-127347930 GGCGGCGCCGCCGCGGAGCTTGG + Intronic
1038046282 8:23768146-23768168 GCTGGCACAGCCCGAGAGCAAGG - Intergenic
1039454548 8:37698178-37698200 GGCGGCGCTGGACGAGAGCGCGG - Exonic
1048675081 8:136769628-136769650 GGCGGAGCTGCCCAAGACCACGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1051268127 9:15328368-15328390 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1051382316 9:16471056-16471078 GGCGGAGCTGCCCAAGACCATGG + Intronic
1053384104 9:37673365-37673387 GGCGGAGCTGCCCAAGACCACGG - Intronic
1056129149 9:83566789-83566811 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1057208193 9:93185367-93185389 GGCGGCGGCGACCGTGAGGAAGG + Exonic
1057316409 9:93971681-93971703 GGCGGAGCTGCCCAAGACCATGG - Intergenic
1057600294 9:96451014-96451036 GTCGGAGCCACCCGAGAGCGCGG + Intronic
1058885690 9:109320231-109320253 GGCCGCGCCGCCGGTGAGCAGGG + Exonic
1061285486 9:129620242-129620264 GGACGCGCCGGCCGACAGCAGGG + Exonic
1186992507 X:15084881-15084903 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1189011403 X:37049080-37049102 GGCAGAGCTGCCCAAGAGCATGG + Intergenic
1189371343 X:40431885-40431907 GGCGGAGCTGCCCAAGACCATGG + Intergenic
1193707825 X:84844578-84844600 GGCAGAGCTGCCCAAGAGCATGG - Intergenic
1193808069 X:86016926-86016948 GGCGGAGCTGCCCAAGACCATGG + Intronic
1195522707 X:105849789-105849811 GGCGGAGCTGCCCAAGACCATGG - Intronic
1195823613 X:108973090-108973112 GGCGGCGCTGCCCAAGACCATGG + Intergenic
1197431829 X:126376470-126376492 GGCAGGGCCGCCCAAGACCATGG - Intergenic
1197766072 X:130060278-130060300 GGCGGCGGCGCGCGAGGGGAGGG + Intergenic
1200629297 Y:5561012-5561034 GGCGGAGCTGCCCAAGATCATGG + Intronic