ID: 1127294405

View in Genome Browser
Species Human (GRCh38)
Location 15:57597004-57597026
Sequence TCTCACCAGGTCCTACGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127294394_1127294405 22 Left 1127294394 15:57596959-57596981 CCACCCCTCCCCAGGCCTGGTGG 0: 1
1: 0
2: 8
3: 123
4: 806
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294398_1127294405 17 Left 1127294398 15:57596964-57596986 CCTCCCCAGGCCTGGTGGAATAG 0: 1
1: 0
2: 1
3: 28
4: 285
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294400_1127294405 14 Left 1127294400 15:57596967-57596989 CCCCAGGCCTGGTGGAATAGGCA 0: 1
1: 0
2: 2
3: 28
4: 423
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294396_1127294405 19 Left 1127294396 15:57596962-57596984 CCCCTCCCCAGGCCTGGTGGAAT 0: 1
1: 0
2: 2
3: 30
4: 308
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294403_1127294405 7 Left 1127294403 15:57596974-57596996 CCTGGTGGAATAGGCAGTTAAAA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294401_1127294405 13 Left 1127294401 15:57596968-57596990 CCCAGGCCTGGTGGAATAGGCAG 0: 1
1: 0
2: 0
3: 26
4: 234
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294397_1127294405 18 Left 1127294397 15:57596963-57596985 CCCTCCCCAGGCCTGGTGGAATA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1127294402_1127294405 12 Left 1127294402 15:57596969-57596991 CCAGGCCTGGTGGAATAGGCAGT 0: 1
1: 0
2: 2
3: 15
4: 188
Right 1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127294405 Original CRISPR TCTCACCAGGTCCTACGTAG AGG Intronic
902880792 1:19370567-19370589 TTTCACCATGTGCTAGGTAGAGG - Intronic
912567562 1:110599238-110599260 TCTCAGCTAGTCCTACTTAGGGG + Intronic
914675485 1:149904639-149904661 TTTCACCAGGGCCTAGGCAGAGG + Exonic
916964278 1:169919152-169919174 TCTTCCCAGGTCCTAAGTGGAGG + Intergenic
1066692442 10:38043731-38043753 TCTCATCAGAGACTACGTAGAGG - Intronic
1076317399 10:129552115-129552137 TCTCAGCAGGTCCCCCTTAGTGG - Intronic
1078715456 11:13834986-13835008 TCTCACCAGGTGATTCTTAGGGG + Intergenic
1083194782 11:61079383-61079405 TCTCACCAGTCCCAACGCAGAGG - Intergenic
1087851151 11:103030975-103030997 TCTCACTAGTTTCTAAGTAGTGG - Intergenic
1098177481 12:67807797-67807819 TCTCCCCAGCTCCTCTGTAGAGG + Intergenic
1124893481 15:33755045-33755067 TCTGTCCATGTCCAACGTAGGGG + Exonic
1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG + Intronic
1138350011 16:56341456-56341478 CCTCACCAGGTGCTATGAAGAGG + Intronic
1143725763 17:8844317-8844339 TCTCACAAACTCCCACGTAGGGG + Intronic
1164712690 19:30368780-30368802 TCTCACCGGGTCCAAGGGAGGGG + Intronic
1167578668 19:50329621-50329643 CCCCACCAGGTCCTGCCTAGCGG - Intronic
931769598 2:65486298-65486320 TCTCAGAAGGTTCTGCGTAGGGG - Intergenic
938086475 2:128405345-128405367 TCTCACCAGGCCCTCACTAGAGG - Intergenic
940638122 2:156321814-156321836 TCTCGCCAGGTCCTATACAGGGG - Intergenic
944209827 2:197195481-197195503 TCTCCCCAGGTGCTACTTACAGG + Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
978468330 4:109033020-109033042 TCCCACCAGGTCCTCCATAAAGG + Intronic
983636298 4:169900931-169900953 TCTCAACACGTCCCCCGTAGGGG - Intergenic
984990763 4:185378519-185378541 TGTCACCAGGTCCCACTAAGTGG - Exonic
987582858 5:19819532-19819554 TCTGACCAGGTCCTAAGGAAGGG + Intronic
992082326 5:73246751-73246773 TCTCACCAGTTCATTCCTAGTGG + Intergenic
994775353 5:104031897-104031919 TGTCACCAGGTGCTCAGTAGGGG - Intergenic
998849995 5:146343255-146343277 TTTCACCAGTTCCTACGTGCAGG + Intergenic
1002655602 5:180744315-180744337 CCTCACCAGTTCCTTCCTAGAGG + Intergenic
1014437605 6:121437717-121437739 TCTCTCCAGGTACAAAGTAGGGG + Intronic
1017014850 6:150091767-150091789 TCTCACCAGGCCCCACAGAGAGG + Intergenic
1020514697 7:9103284-9103306 TCCCACCATGTACTACTTAGTGG + Intergenic
1026269231 7:68822052-68822074 TCTCACGAGGCCCTAAGAAGTGG - Intergenic
1037484662 8:19336023-19336045 TCTCACTAGGTCCTAGGAGGAGG - Intronic
1049440612 8:142607857-142607879 TCTCACCAGGTCGGACGTTCAGG + Intergenic
1053135442 9:35647538-35647560 TCTCCCCAGGGCCTCTGTAGAGG - Intergenic
1189119831 X:38382770-38382792 TTTCACCTGGTCCTATATAGAGG - Intronic
1197121219 X:122895357-122895379 TCTCACCAGCTCCTAGTTGGTGG - Intergenic