ID: 1127295323

View in Genome Browser
Species Human (GRCh38)
Location 15:57604156-57604178
Sequence CAGTGTTCCCCAATGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127295319_1127295323 3 Left 1127295319 15:57604130-57604152 CCTCTATGGCTCCTGTATGATCA 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
1127295321_1127295323 -8 Left 1127295321 15:57604141-57604163 CCTGTATGATCAGGACAGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
1127295318_1127295323 11 Left 1127295318 15:57604122-57604144 CCTTATCTCCTCTATGGCTCCTG 0: 1
1: 0
2: 1
3: 24
4: 230
Right 1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127295323 Original CRISPR CAGTGTTCCCCAATGGAAGT AGG Intronic
903376251 1:22868078-22868100 CAGAGCTCCCAAATGGATGTAGG - Intronic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
906474664 1:46160871-46160893 GAGTGTTCCCCAAAGGAAAATGG + Intronic
912254394 1:108044344-108044366 CAGGGTTCCCAAATGAGAGTTGG + Intergenic
912659480 1:111515463-111515485 TGGTGTTCCCCGATGGGAGTTGG + Intronic
922685979 1:227639129-227639151 CAGAGGACCCCACTGGAAGTTGG - Intronic
1063187661 10:3665512-3665534 CAGTGTCCCCCAGTGAGAGTCGG + Intergenic
1065687408 10:28300365-28300387 CAGTGTCCCACAATGCAAGAGGG + Intronic
1066002365 10:31116474-31116496 CAGTGTTGCTCAAAGGCAGTGGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070588618 10:77785607-77785629 CATTGTTACCCCATGGAAGTTGG + Intergenic
1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG + Intronic
1071054642 10:81494921-81494943 CTGTCTTCCCCAAAAGAAGTCGG - Intergenic
1071755831 10:88537949-88537971 CAGGGTTCCCCAGGGGAACTTGG + Intronic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1079351585 11:19696262-19696284 CAGTGTTCCCATCTGGAATTAGG + Intronic
1081704504 11:45173250-45173272 CATTACTCCCCACTGGAAGTTGG - Intronic
1083266496 11:61549391-61549413 CAGTGTTCCCCAAACTTAGTTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084502653 11:69544087-69544109 CAGGGTTCTCCCATGGAAATAGG - Intergenic
1090055290 11:123418280-123418302 CAGGGTTTCCCAAGGGGAGTTGG + Intergenic
1092182152 12:6453238-6453260 CAGTGTGCCCCCTTGGAAATCGG - Exonic
1092615965 12:10215708-10215730 CATTGTGCCCCAAAGGAACTCGG - Intronic
1094072916 12:26438535-26438557 CAGTGTTTCCTAATAGACGTGGG + Intronic
1094382933 12:29863362-29863384 CAGGCTTCCTCAAGGGAAGTGGG + Intergenic
1096718333 12:53504161-53504183 AAGTGTTCCAGAATGGAAATGGG + Intronic
1099359374 12:81680799-81680821 CAGTGTTGTCCAGTGGAAATTGG + Intronic
1100402941 12:94248006-94248028 CAGGGTTCCACAATCCAAGTAGG - Exonic
1101278968 12:103230628-103230650 CATTGTTCTCCAGTGGTAGTGGG - Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1107625762 13:42281860-42281882 CAGTGGTCACCCATGCAAGTGGG - Intronic
1107828594 13:44353364-44353386 CAGTGTTCCCCAGTGTGAATGGG - Intergenic
1114237284 14:20834215-20834237 CAGAGGACCCCACTGGAAGTTGG - Intergenic
1114578406 14:23734197-23734219 CTGTTTTCCACAGTGGAAGTCGG - Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1118941901 14:70346477-70346499 CAGAGGACCCCAATGGAAATTGG + Intronic
1124903622 15:33847610-33847632 CTGTGTTCCCCTTTGGCAGTAGG + Intronic
1126915335 15:53460115-53460137 CAGTGTTCCCCAAGGGGAAGGGG - Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1129756120 15:78100315-78100337 CAGTGGACCACAATGGAGGTGGG + Intronic
1134471201 16:14527743-14527765 CAGTGTTCCTGAATGCAAGAAGG - Intronic
1138305413 16:55970034-55970056 CAGTGCACCCCAAAGGGAGTGGG - Intergenic
1140942476 16:79734813-79734835 CAGTTTTCCCCAGTGGAGGCTGG + Intergenic
1141188931 16:81809400-81809422 CAGGCTTCCCCAATGGACTTCGG + Intronic
1143019237 17:3908088-3908110 CAGTGTTGCTCAGTGGAGGTGGG - Intronic
1146542348 17:33708236-33708258 CAGAGTTCCAGAATGGAAATTGG + Intronic
1152091410 17:78249713-78249735 CAGTGCTCCACAATGTAGGTGGG + Intergenic
1153862920 18:9232602-9232624 CAGTGTTCCCCAATGCAAAAAGG - Intronic
1155437360 18:25827138-25827160 CAGTTTTCCCCAATAAAATTGGG + Intergenic
1155630380 18:27886310-27886332 CAGTGGTCCCCAAGGGAATGAGG - Intergenic
1155958691 18:31975681-31975703 CACTCTTCCCCAATGAAGGTGGG + Intergenic
1156536753 18:37871827-37871849 CAGTGATGCTCAATGGAAGGAGG - Intergenic
1160247098 18:77167713-77167735 AAGTGTTCCCCAAAGGAAAGGGG - Intergenic
1161109731 19:2462447-2462469 CAGTTTTCCATAATGGAAATGGG - Intergenic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1168441039 19:56367513-56367535 CAGTGATCCACAATGTGAGTTGG + Intronic
926534619 2:14095720-14095742 CATACTTCCACAATGGAAGTGGG - Intergenic
928658548 2:33478006-33478028 CAGTGTTCCCTCATGGCAGGGGG - Intronic
929661327 2:43787976-43787998 CAGGATTCACCAATGAAAGTGGG + Intronic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
932733309 2:74235691-74235713 CAATGATCCCCAGTGGAATTGGG - Intronic
935785057 2:106541278-106541300 TAGTGACCCCCTATGGAAGTAGG + Intergenic
940111259 2:150156823-150156845 AAGTTTTCCCCAGTGGAATTTGG + Intergenic
941181295 2:162262509-162262531 CAGTGTAACCCAATTGAAGCTGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
1169049110 20:2561598-2561620 CAGTGTTCCCCAACAGAAATAGG - Intronic
1170494850 20:16914879-16914901 CAGTGTTCCACAGAGGTAGTGGG + Intergenic
1171185555 20:23121806-23121828 CAGTGCTCTCCGCTGGAAGTCGG - Intergenic
1171865693 20:30486204-30486226 CAGTGTTCCGCCAGGGCAGTAGG + Intergenic
1175133240 20:56805210-56805232 CAGTGTTCCCCAAGGTTGGTGGG + Intergenic
1175801533 20:61803681-61803703 CTGCGTTCCCCAAGGGAGGTTGG + Intronic
1178517804 21:33263587-33263609 AAGTGTTCTCCAAGGGAAGGAGG + Exonic
1179101883 21:38361408-38361430 CAGTCTTCCCTAATGGCTGTTGG + Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179667547 21:42923109-42923131 CAGAGGACCCCACTGGAAGTCGG - Intergenic
1180142766 21:45902270-45902292 CAGTGTTCCCCTATCGTAGGTGG + Intronic
1180142781 21:45902330-45902352 CAGTGTTCCCCTATCGTAGGTGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1183384908 22:37509182-37509204 CATTGTTCCACACAGGAAGTGGG - Intronic
951943639 3:28110131-28110153 GATTCTTCCCCAATGGCAGTTGG + Intergenic
952160288 3:30686705-30686727 CACTGTTCTCCAAAGTAAGTAGG - Intronic
953156788 3:40382760-40382782 CTGTGTGCCCCCATGGCAGTGGG - Intergenic
957318635 3:78600924-78600946 CAGAGTTCCACAATGTAAATAGG - Intronic
957624891 3:82644135-82644157 CAGTGGTCCCCACTGCAAATTGG - Intergenic
957865243 3:86014507-86014529 CAGTGTTCACCAAGGTAACTTGG + Intronic
958119995 3:89273860-89273882 CAGTGTTCCTAAATGCAAGAAGG - Intronic
959341441 3:105136450-105136472 CAGTGTGCCTTTATGGAAGTGGG + Intergenic
959841037 3:110975330-110975352 CAGTGTTCCTCAAAGTAATTGGG + Intergenic
964617288 3:158680866-158680888 CAGTGCTGCCCAATAGAACTTGG + Intronic
965792601 3:172405619-172405641 CAGTGTTTCCCAAAGTAAGGTGG + Intergenic
970139970 4:12971432-12971454 CATTGTTCAACAATGGTAGTAGG - Intergenic
972309321 4:37865127-37865149 CAATGTTCCCCAATGGAAAGAGG - Intergenic
974697690 4:65397094-65397116 CAGTGGTCCCCATTGCAAATTGG - Intronic
980667885 4:135962325-135962347 CATTGTTATCCAATGGAATTTGG + Intergenic
1202754354 4_GL000008v2_random:44505-44527 CAAAGTTCACCAATGAAAGTTGG + Intergenic
989585807 5:43073157-43073179 CAGAGGACCCCACTGGAAGTTGG - Intronic
990000172 5:50883349-50883371 TAGTGTTCCCAAATGAAGGTTGG + Intergenic
990441371 5:55848786-55848808 TAGTGTTTCCCATTTGAAGTGGG - Intergenic
992183732 5:74223278-74223300 CAGTGGTCCTCATTGGAGGTAGG - Intergenic
996890264 5:128411015-128411037 CAGTGTTGCCCAATTGAGATGGG + Intronic
1002152112 5:177242717-177242739 CAGGGTTTCTCAATGGTAGTCGG + Intronic
1002296725 5:178235494-178235516 CAGTGTTCCCCTATGTAAAATGG + Intergenic
1005380479 6:25229277-25229299 CTGTGTTCTCCAATGGGAGAAGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1011417496 6:87137793-87137815 CAGTCTTCCCCAGGGGAAGCTGG + Intergenic
1012198895 6:96380337-96380359 ATCTGTTCCCTAATGGAAGTTGG + Intergenic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1019270103 7:142136-142158 GAGCCTTCCCCATTGGAAGTGGG + Intergenic
1023968092 7:44973763-44973785 CAGAGTTCCCCCATTGAAGGGGG - Intronic
1025088871 7:56046006-56046028 TTGTGTTACCCCATGGAAGTTGG - Intronic
1025900980 7:65744619-65744641 TTGTGTTACCCCATGGAAGTTGG - Intergenic
1026443733 7:70465827-70465849 CTGTGTACCCCCATGCAAGTGGG + Intronic
1026932945 7:74234962-74234984 CAGTGTTTCCCAACTGCAGTGGG - Intronic
1029246719 7:99207360-99207382 CACTGGTCCCCAATAGAAGCAGG + Intronic
1029702164 7:102254305-102254327 CAGTGTTCCCCAAAGCCAGCTGG - Exonic
1031887524 7:127256813-127256835 CAGAGTTCCCCACTGGGATTAGG - Intergenic
1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG + Intergenic
1037526660 8:19731014-19731036 CAGGGATCCCCACTGGAATTAGG + Intronic
1038827682 8:31022617-31022639 CACTGTACCCTATTGGAAGTGGG - Intronic
1039843812 8:41311565-41311587 CAGTTTTCCCGAATGGCAGGAGG + Intergenic
1041460977 8:58111490-58111512 CAGTGTTCCCACATGGAACCAGG - Intronic
1044465814 8:92503623-92503645 CAGTGTTCCCCTTTGCAAGGAGG - Intergenic
1046734268 8:117759693-117759715 CAGTGCCCCCAAATGGTAGTAGG + Intergenic
1051363565 9:16303777-16303799 CAGTGTTCTCCCATGGAATGTGG - Intergenic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1061464146 9:130764429-130764451 CACAGTCCCCCAATGGAAGCGGG - Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1185856236 X:3538800-3538822 CTGTTTTTCACAATGGAAGTTGG - Intergenic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1186788984 X:12978668-12978690 CAGTGTTCCTCAGTTGAAGAAGG + Intergenic
1189417127 X:40825230-40825252 CTGTGTTCCCCAACTGATGTAGG - Intergenic
1195385064 X:104306379-104306401 AAGTGCTCCCTAATGGCAGTCGG + Intergenic
1195833462 X:109086124-109086146 TAGTATTCTCCAATGGTAGTAGG + Intergenic
1197173257 X:123457523-123457545 CAGTGTTCCTCAAAGGAAAATGG - Intronic
1198235166 X:134730348-134730370 CAAGGTTTCCCAATGGGAGTGGG + Intronic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic