ID: 1127298131

View in Genome Browser
Species Human (GRCh38)
Location 15:57627767-57627789
Sequence GACCAGGATTTTTCTAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127298131_1127298136 7 Left 1127298131 15:57627767-57627789 CCAGGATTAGAAAAATCCTGGTC 0: 1
1: 0
2: 0
3: 14
4: 83
Right 1127298136 15:57627797-57627819 CCAGAGTGTAGGTTTTTGTGTGG 0: 1
1: 0
2: 3
3: 41
4: 314
1127298131_1127298134 -4 Left 1127298131 15:57627767-57627789 CCAGGATTAGAAAAATCCTGGTC 0: 1
1: 0
2: 0
3: 14
4: 83
Right 1127298134 15:57627786-57627808 GGTCTCTTGGACCAGAGTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127298131 Original CRISPR GACCAGGATTTTTCTAATCC TGG (reversed) Intronic
905614270 1:39383333-39383355 AACAAATATTTTTCTAATCCGGG + Intronic
912224334 1:107716162-107716184 GACCAGGATTTTTATAAGTTTGG + Intronic
919332182 1:196186156-196186178 CACCAGGATAGTTCTAATACTGG - Intergenic
920199868 1:204252933-204252955 GAGCAGGAGTGTTCTCATCCTGG + Intronic
1063455121 10:6177819-6177841 GGCCAGGATGTTTCTGATGCAGG + Intronic
1071972159 10:90918896-90918918 GACAAGAATTTTTCTACTACTGG + Exonic
1072777271 10:98211406-98211428 GAACAGTATTTTTCTAATTATGG - Intronic
1079547549 11:21651962-21651984 GTCCAGGATATTACTAATCATGG - Intergenic
1087085339 11:94212707-94212729 GAGCAGCATGTTTCTAATACCGG - Intergenic
1087937207 11:104048782-104048804 TACCACTATTTTTCTAATTCCGG - Intronic
1087969938 11:104467872-104467894 AAACAGGAATTTTCTATTCCTGG - Intergenic
1096243143 12:49970072-49970094 GCCCAGGACTTGTCTACTCCTGG - Intronic
1105544338 13:21340713-21340735 GACCAGGGTTTAGCTCATCCTGG + Intergenic
1106554943 13:30801522-30801544 GACCACTATTTTTGGAATCCAGG + Intergenic
1110525181 13:76527895-76527917 TACCAGGATATTTGTCATCCTGG - Intergenic
1111525283 13:89460317-89460339 TTCCAGGATTTTTCTAGTTCTGG - Intergenic
1112639427 13:101256180-101256202 GTCCAGGATTTTACAATTCCAGG - Intronic
1112926999 13:104688451-104688473 AATCAGGATTTTACTCATCCAGG - Intergenic
1115105680 14:29758793-29758815 GACAGGGACTTCTCTAATCCTGG - Intronic
1116347346 14:43811682-43811704 GTCCAGTTTTTTTCTGATCCAGG - Intergenic
1117875566 14:60248294-60248316 GAACAGGATTTTTCAAAATCAGG - Intronic
1121458134 14:94052251-94052273 GACCAGGAGTTTTCTCAAGCAGG + Intronic
1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG + Exonic
1127298131 15:57627767-57627789 GACCAGGATTTTTCTAATCCTGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1129951110 15:79592399-79592421 GACCAGGAGATTGCTAGTCCGGG - Intergenic
1130140899 15:81225507-81225529 GATCAGGATATTTCTCATCAGGG - Exonic
1133603779 16:7366171-7366193 GACCAGGATGATTTTAAGCCAGG + Intronic
1139667191 16:68465820-68465842 CACCAGCAGTTTTCTAACCCTGG - Intergenic
1140811632 16:78584494-78584516 GACAAGGACTGTTCTAAGCCCGG + Intronic
1140840358 16:78832629-78832651 GATGATGACTTTTCTAATCCAGG - Intronic
1141942455 16:87286533-87286555 GAGCAGGATTTTTCTGAGTCTGG - Intronic
1141977891 16:87529763-87529785 GGCAAGGATTTTTCCAATTCAGG + Intergenic
1142787829 17:2238106-2238128 AACCTGGAGTTTTCTAATCCAGG - Intronic
1143116187 17:4583015-4583037 GACCAGGGTTTTTGAACTCCAGG + Intergenic
1143995717 17:11004839-11004861 GGCAAGGATTTTCCTAGTCCTGG - Intergenic
1153915817 18:9743342-9743364 GATCAAGATGTTTATAATCCAGG - Intronic
1159555112 18:69937770-69937792 GGCCAACATTTTTCTAATGCTGG - Intronic
1165931780 19:39363882-39363904 GGCCAGGCTTTTTCTGATCTGGG + Intronic
931520129 2:63087491-63087513 GACCATGTTATTTCTACTCCAGG + Intergenic
935251181 2:101262601-101262623 GACCCGGATTCTTCTAATTCTGG + Exonic
935665144 2:105505112-105505134 GATAAAGATTTTTCTAGTCCAGG + Intergenic
938735298 2:134180426-134180448 TACCAGGATGTTTGTAATCCTGG + Intronic
941527318 2:166622428-166622450 GAACAATATTTTTCCAATCCAGG + Intergenic
942983267 2:182107299-182107321 GCCCAGAATTCTTCTAATCTAGG + Intronic
1170406684 20:16045239-16045261 GACCAGGCTTTTTATTTTCCTGG - Intronic
1172271431 20:33657725-33657747 GACCAGGACTTGTCTCCTCCTGG - Exonic
1174933992 20:54847374-54847396 GAACTGGATTTTGCTAAGCCTGG + Intergenic
1180129928 21:45820788-45820810 CACCAGGATATTTCTAAACCGGG - Intronic
1182823826 22:33244798-33244820 CACCAGGATGCTTCTAATCATGG + Intronic
1185068587 22:48644238-48644260 GACCAGGGTTTTGCTCATCGTGG + Intronic
953764673 3:45729018-45729040 GACCAGGATTTCAATAATACTGG + Intronic
963207976 3:142655916-142655938 GCCCAGGATTTGGCAAATCCAGG + Intronic
965114540 3:164470883-164470905 GACAAGCATTTTTCTAACCCTGG + Intergenic
965554886 3:170008516-170008538 TACAAGCATTTTTCTAATGCTGG + Intergenic
967386762 3:188919636-188919658 GATCAGAATTCTTCTCATCCAGG - Intergenic
967529354 3:190531331-190531353 GAACAGGCTTTTTGTAACCCAGG + Intronic
967937915 3:194743923-194743945 GACCAGGCTATTCCTATTCCTGG + Intergenic
971611009 4:28726440-28726462 GACCTTGATTCTTCCAATCCAGG + Intergenic
971738927 4:30495914-30495936 GAAGAGCATTTTTCTAATCCTGG + Intergenic
973194914 4:47428604-47428626 TACCAGGATTTTTATAATGCTGG - Intergenic
975642474 4:76513822-76513844 GACTTTGATTTTTCTTATCCGGG + Intronic
977849418 4:101807777-101807799 GACCTGGATTTTTAAAATTCAGG + Intronic
983412045 4:167412846-167412868 GACCAGCTTTTTTCTTATGCCGG - Intergenic
991130717 5:63119639-63119661 GTCCAGCATTTTTCTACTTCAGG - Intergenic
991551899 5:67846150-67846172 GAGAAGGCTTTTTCTAATCCAGG - Intergenic
994044737 5:95295271-95295293 GACCAAGATTTTTATTATGCAGG - Intergenic
995906388 5:117129000-117129022 GACCAGGATTTTGCTAAATTAGG + Intergenic
995913512 5:117215802-117215824 GCAGAGGCTTTTTCTAATCCTGG + Intergenic
998841776 5:146261854-146261876 GATCAGTATTTTTCAATTCCTGG + Intronic
1002332305 5:178452438-178452460 GATGAGAATCTTTCTAATCCAGG + Intronic
1003407749 6:5837678-5837700 GACCAGGGTTTAGCTCATCCTGG - Intergenic
1008603597 6:53119093-53119115 GACCAGGATTGTTTTTTTCCAGG - Intergenic
1014258492 6:119188275-119188297 GACCAGGATTTTTTCCACCCAGG - Intronic
1015385279 6:132615593-132615615 GAACATGATTTTACTAATCCTGG + Intergenic
1016269838 6:142275959-142275981 AATCAGGATTTTTCTCTTCCAGG - Intergenic
1017439699 6:154452298-154452320 GAGAAGAATTTTTATAATCCTGG - Intronic
1020019454 7:4854184-4854206 GACCAGGCTTTTTCTACTTTCGG - Intronic
1021206456 7:17786800-17786822 GACTGGGATGTTTCTGATCCCGG - Intergenic
1022959359 7:35411765-35411787 TACCAGGATTATTTTAAACCTGG - Intergenic
1024326277 7:48111618-48111640 GACAACGATTTTTGAAATCCAGG - Intergenic
1031192259 7:118568052-118568074 GAACAAGATTTTTCTAATACTGG + Intergenic
1036491501 8:9230391-9230413 GACCATGCTTTATCAAATCCAGG - Intergenic
1038769884 8:30467585-30467607 AACCAGGATGTTTCTGCTCCTGG + Intronic
1039979754 8:42398706-42398728 TACCAGGAATTTTCTACTTCTGG + Exonic
1041427743 8:57741745-57741767 GTCCAGCATTTTTCAAATTCAGG - Intergenic
1048615957 8:136075882-136075904 GACCAGGGTTTTACTAAGGCAGG + Intergenic
1055465329 9:76559742-76559764 CACCATGATTTTTCCACTCCAGG + Intergenic
1188829743 X:34881693-34881715 GTCTAGAAGTTTTCTAATCCTGG + Intergenic
1189144822 X:38644944-38644966 GAACAGGATTATTCTAACCCAGG + Intronic
1191680613 X:63836333-63836355 GACCACGTTTTGTCTCATCCAGG - Intergenic
1192701132 X:73474699-73474721 AAGCAAGATTTTTCTCATCCAGG - Intergenic
1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG + Intergenic
1195753996 X:108182956-108182978 GACCATTGTTTTTCTCATCCCGG - Intronic
1198010085 X:132543531-132543553 GTCCAAGATTTTTCAAATTCTGG - Intergenic
1202256901 Y:22931215-22931237 GCCCAAGATTTTTCTAAGCCAGG - Intergenic
1202409892 Y:24564963-24564985 GCCCAAGATTTTTCTAAGCCAGG - Intergenic
1202460890 Y:25105109-25105131 GCCCAAGATTTTTCTAAGCCAGG + Intergenic