ID: 1127298343

View in Genome Browser
Species Human (GRCh38)
Location 15:57629522-57629544
Sequence GGTCTCCCATGGTGGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127298343_1127298347 -2 Left 1127298343 15:57629522-57629544 CCTCTTGGCCACCATGGGAGACC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1127298347 15:57629543-57629565 CCCACAGTCCCTCACAGCACAGG 0: 1
1: 1
2: 2
3: 42
4: 324
1127298343_1127298352 10 Left 1127298343 15:57629522-57629544 CCTCTTGGCCACCATGGGAGACC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1127298352 15:57629555-57629577 CACAGCACAGGGTCCCAGACTGG 0: 1
1: 0
2: 2
3: 34
4: 321
1127298343_1127298349 -1 Left 1127298343 15:57629522-57629544 CCTCTTGGCCACCATGGGAGACC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1127298349 15:57629544-57629566 CCACAGTCCCTCACAGCACAGGG 0: 1
1: 0
2: 0
3: 23
4: 293
1127298343_1127298355 28 Left 1127298343 15:57629522-57629544 CCTCTTGGCCACCATGGGAGACC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1127298355 15:57629573-57629595 ACTGGCAGTTGCTGTAGCCTAGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127298343 Original CRISPR GGTCTCCCATGGTGGCCAAG AGG (reversed) Intronic
901070142 1:6512879-6512901 GGCCTCACAGGGTGGCCATGGGG + Intronic
902735154 1:18395723-18395745 GGGCTTCCATGGTGGGAAAGAGG + Intergenic
904577527 1:31514569-31514591 GCTCTCCCATGAAGGCCCAGAGG - Intergenic
906479058 1:46188537-46188559 GGCATCCCCTGGTGGCCAAATGG + Intergenic
908094512 1:60722460-60722482 TTTCTCCCCTGTTGGCCAAGTGG + Intergenic
911505864 1:98750294-98750316 GGCATCACATGGTGGCTAAGGGG + Intronic
917345661 1:174025514-174025536 GGTCTTCTATGTTGGCCAGGTGG - Intergenic
917580100 1:176368246-176368268 GGTCTTCCGAGGTGGCTAAGAGG + Intergenic
918136848 1:181681363-181681385 GGCCCCCCAAGATGGCCAAGTGG - Intronic
922209531 1:223476929-223476951 GGTCTCCAATGGTGGCCGTCTGG + Intergenic
922902736 1:229149907-229149929 TCACTCCCATGGTGTCCAAGTGG + Intergenic
923534103 1:234835331-234835353 GGGTCCCCAGGGTGGCCAAGTGG + Intergenic
924844288 1:247749898-247749920 GGTCTCAGATGCTGGCCTAGTGG - Intergenic
1063438100 10:6050687-6050709 CATCTCCTATGGTGGCCATGAGG + Intronic
1065009230 10:21406563-21406585 GGACTCCCCTCTTGGCCAAGGGG - Intergenic
1066321698 10:34309143-34309165 GGTCTGCTGTGGTGGGCAAGAGG + Intronic
1068090051 10:52422245-52422267 GGTTCCCAATGGTGGTCAAGAGG + Intergenic
1069771901 10:70905600-70905622 GGTCTCTCTTTGTGGCCCAGTGG + Intergenic
1070092100 10:73297467-73297489 TGTCTCTCATGGTGGCCATATGG + Intronic
1071029786 10:81163547-81163569 GTTTTACCATGTTGGCCAAGCGG + Intergenic
1072269253 10:93759585-93759607 GGTATCACATGGGGGTCAAGAGG + Intronic
1072288393 10:93939546-93939568 GGGCTCCCATGGTAGACCAGTGG + Intronic
1072662160 10:97369836-97369858 GGTCTCATGTGGTTGCCAAGAGG + Intronic
1073267618 10:102237470-102237492 GGCCTCCAATGGGGGACAAGGGG + Intronic
1074889737 10:117725528-117725550 GGGCTGCCATGGTGGCTGAGGGG - Intergenic
1075485904 10:122821957-122821979 GGTCTTCCCTGATGGCCCAGAGG - Intergenic
1077342137 11:2030892-2030914 GGGCTCCCCAGGTGGCCAGGGGG + Intergenic
1080859005 11:36136883-36136905 GTTTTGCCATGTTGGCCAAGTGG + Intronic
1080966868 11:37223973-37223995 TGTATCCCATGCTTGCCAAGGGG + Intergenic
1083398408 11:62406963-62406985 GGATTCCCAGGGTGGCCAGGAGG + Intronic
1085481428 11:76825746-76825768 GGACCCCCATCTTGGCCAAGGGG + Intergenic
1089016222 11:115167515-115167537 GGTCTTCCATGTTGGCAGAGGGG + Intergenic
1202825123 11_KI270721v1_random:86081-86103 GGGCTCCCCAGGTGGCCAGGGGG + Intergenic
1091883157 12:3996288-3996310 GGTTTACCAAGTTGGCCAAGGGG - Intergenic
1100921024 12:99486972-99486994 TGCCTGCCATGGTGGACAAGGGG + Intronic
1101953660 12:109195445-109195467 GGTCCCCAAAGGTAGCCAAGAGG - Intronic
1102692736 12:114774140-114774162 TGTTTCCCATGGTTGCCAAAAGG - Intergenic
1105050741 12:133048589-133048611 GGTCTCCCTTGGTGGCTAATAGG - Intronic
1106865275 13:33957830-33957852 AGTCTCCCAGGCTGGCCAGGTGG + Intronic
1107497199 13:40938190-40938212 GGTCTCCAATGTTTACCAAGGGG + Intronic
1113812397 13:113150608-113150630 GGTCTCCCAGGGTGGGCGGGAGG + Intergenic
1114229016 14:20763681-20763703 GGTTTCACATGTTGGTCAAGCGG - Intergenic
1116336589 14:43665460-43665482 GAGCACCCATGGTGGTCAAGTGG - Intergenic
1117222030 14:53616125-53616147 GGTCTGCCAAGATGGACAAGTGG - Intergenic
1118465331 14:66025355-66025377 GGTCTCCCTTGAAGGCCATGTGG - Intergenic
1119447930 14:74682071-74682093 GTTCTCCACTGGTGGCAAAGAGG + Intronic
1121878791 14:97480431-97480453 GGTTCCACATGGTGGCCAGGAGG + Intergenic
1122824836 14:104364556-104364578 GGTCTTCCATGGTGCCCTGGAGG + Intergenic
1124638987 15:31383317-31383339 GCTCTCCCACCGTGGCCCAGTGG + Intronic
1127298343 15:57629522-57629544 GGTCTCCCATGGTGGCCAAGAGG - Intronic
1127393337 15:58524072-58524094 GGTTACCCATGGTGGGAAAGGGG - Intronic
1128082546 15:64865132-64865154 GGTCTCCCCTGAGAGCCAAGAGG + Exonic
1128126326 15:65195677-65195699 GGTCTGACAAGCTGGCCAAGTGG - Exonic
1129727179 15:77907307-77907329 TTTCTCCCAGGGTGGCCATGGGG + Intergenic
1129813595 15:78531783-78531805 GGCCTCCCAAAGTGGCCAAAGGG + Intronic
1130958953 15:88647157-88647179 AGTAGCCCATGGTGGCCAGGAGG + Intronic
1131399646 15:92114061-92114083 GATCTCCCCTGGGGGCCAACAGG + Intronic
1131453676 15:92566517-92566539 GGACCCCCCTGTTGGCCAAGGGG + Intergenic
1133807482 16:9136635-9136657 GGTTTCCCATGTTGGCCAGGCGG + Intergenic
1134154782 16:11834087-11834109 AGTCTCCCCCGGGGGCCAAGAGG - Exonic
1134450038 16:14357759-14357781 GGCCACCCATTGGGGCCAAGGGG - Intergenic
1134489120 16:14682624-14682646 GGTCTGCTCTGGTGGCAAAGAGG - Intronic
1134629345 16:15745779-15745801 GGTTTCCCATGTTGGCCAGGTGG + Intronic
1135290270 16:21230491-21230513 GTTTTGCCATGTTGGCCAAGTGG + Intergenic
1136541296 16:30928734-30928756 GGACACCCACCGTGGCCAAGTGG - Intronic
1137803868 16:51285763-51285785 GGTCTCCCAGGGTTCCCCAGTGG - Intergenic
1138678315 16:58667438-58667460 AGGCTCCCAGGGTGACCAAGAGG + Exonic
1139769705 16:69264126-69264148 GGTCTCCCACAGTCGCGAAGAGG + Intronic
1143188024 17:5022298-5022320 GGTCAGCCATGGTGGCCCAGCGG - Exonic
1143312213 17:6001732-6001754 CTTCTCCCATAGTGGCCATGAGG + Intronic
1143868463 17:9940910-9940932 TGTCTCCCACTGTGGCCCAGAGG - Intronic
1146620153 17:34390880-34390902 GGTCTCCCATGGTAACCAGGCGG - Intergenic
1147313614 17:39608388-39608410 GCTGTCCCTTTGTGGCCAAGGGG - Intronic
1148039586 17:44696160-44696182 ACTTTCCCATGGTGGGCAAGGGG - Intergenic
1151348765 17:73519258-73519280 CGTCTCCAAGGGTGGGCAAGAGG - Intronic
1151518070 17:74609701-74609723 GCACTCCCATGAGGGCCAAGCGG - Intergenic
1152316206 17:79581850-79581872 GATTCCCTATGGTGGCCAAGTGG - Intergenic
1153979905 18:10299896-10299918 GGGCTCACATGGTGGCCATGTGG - Intergenic
1154171837 18:12057731-12057753 GGTCAGGCATGGTGGCCCAGCGG + Intergenic
1155423735 18:25684515-25684537 GGTCACCAAAGGTGGCCAAAAGG + Intergenic
1159759095 18:72402373-72402395 GGTCTTCCATGGATGTCAAGGGG + Intergenic
1160017518 18:75155794-75155816 GGTCTCGCATGGCGCCCCAGGGG + Intergenic
1161154249 19:2723948-2723970 GCTCGCCCACGGTGGCCTAGTGG + Intronic
1161154537 19:2725788-2725810 GGTCTTCCATGGTGGCCTGGGGG - Intronic
1161994454 19:7703804-7703826 GGTCTGCCGTGGTGGCCAGGTGG - Intergenic
1162344770 19:10112738-10112760 GTTTCCCCATGTTGGCCAAGAGG - Intronic
1162554426 19:11378076-11378098 GGACTCCCAGGGAGCCCAAGGGG - Exonic
1163266558 19:16225848-16225870 GGCCTCCCTGGGAGGCCAAGAGG + Intronic
1163861821 19:19746930-19746952 GGCCTGCCGTGGAGGCCAAGAGG - Intergenic
1164480483 19:28607782-28607804 GGCCCCCCATGGTGGTTAAGAGG + Intergenic
1164756628 19:30694789-30694811 CCTCCCCCATGGGGGCCAAGTGG - Intronic
1165742977 19:38214514-38214536 GGTTTCCCATGGTGGGCTTGTGG - Intronic
1166340707 19:42135018-42135040 GGTCCCCAGGGGTGGCCAAGAGG - Intronic
1167267325 19:48490057-48490079 CCTCTCCCAAGGTGGCCACGAGG + Intronic
1167665186 19:50819489-50819511 GGTCTCCAGTCCTGGCCAAGGGG + Intronic
925184732 2:1839277-1839299 GGTGCCCCTTGGCGGCCAAGAGG - Exonic
925615858 2:5744033-5744055 GGTCTCTCATGGTGGCCCCAGGG + Intergenic
926685885 2:15697170-15697192 GGTCTCCCATGGTGCAGCAGCGG + Intronic
929720453 2:44362229-44362251 GGTCTCCCAGAGCTGCCAAGAGG - Intronic
933689938 2:85172116-85172138 GGGCTCCCCTGGTGGACACGTGG - Intronic
937829081 2:126400211-126400233 TGTTTCACATGGTGGACAAGAGG - Intergenic
938948344 2:136234846-136234868 GGTCTCCAATGGTGGCGAAGAGG + Intergenic
939563865 2:143764254-143764276 AGTCCCCCACGGTGGCCCAGTGG + Intronic
946142359 2:217702550-217702572 CGTCTGCCATGGTGACCCAGGGG + Intronic
947517334 2:230817476-230817498 AGTCTCCCACTGGGGCCAAGGGG + Intronic
948750274 2:240128182-240128204 CGCCTCCCAGGGTGGCAAAGGGG - Intronic
1172717271 20:36974247-36974269 GTTTTGCCATGTTGGCCAAGAGG - Intergenic
1172848609 20:37944791-37944813 GGTCACTCATGGAGGCCTAGGGG + Exonic
1175507358 20:59495357-59495379 TGTGTCCCGTGGTGCCCAAGAGG + Intergenic
1178441661 21:32603390-32603412 GGCCTCCCATGGTGAGCACGGGG - Intronic
1178775819 21:35549437-35549459 GGCTTCCCATAGTGGTCAAGTGG + Intronic
1180087466 21:45514410-45514432 GGTCTCCCGAGGTGGCTCAGGGG - Exonic
1180305274 22:11068153-11068175 GGGTACCCATGGAGGCCAAGTGG + Intergenic
1184399424 22:44265174-44265196 GGTCTCCCTTGGTACCAAAGGGG - Intronic
1184471376 22:44698140-44698162 GGTCCCCCTTGGTGACCAAGGGG + Intronic
951971389 3:28448588-28448610 GTTTTTCCATGGTGGCCAGGCGG - Intronic
952654696 3:35771160-35771182 GACTTCCCATGCTGGCCAAGTGG - Intronic
952812467 3:37416579-37416601 GGTTTCCCATGGTGGCAAAATGG - Exonic
952872006 3:37909395-37909417 GGTCTTTCAGGGTGGCCAAGTGG + Intronic
953209848 3:40866267-40866289 TGTCTGACATGGTGGACAAGGGG - Intergenic
954371273 3:50170760-50170782 GGTCGCGCATGGTGGGGAAGGGG - Intronic
955045719 3:55357939-55357961 GGACTCCCAAGCTGCCCAAGAGG + Intergenic
959123044 3:102255682-102255704 GGTAACCCATGCAGGCCAAGTGG - Intronic
960188091 3:114669077-114669099 GTTCTCCCCTGGTGGGGAAGGGG - Intronic
961231845 3:125319991-125320013 GTTCTCCCATAGTAGCCATGAGG - Intronic
961451796 3:127005598-127005620 GGTGTCCCATGGTGACCCAGAGG + Intronic
962533016 3:136301197-136301219 TGTCTGACATGGAGGCCAAGTGG - Intronic
964771438 3:160226812-160226834 GGTCTCCCAGGGTGGGCAGAGGG + Exonic
967159853 3:186726123-186726145 GTTTCACCATGGTGGCCAAGCGG + Intronic
968592378 4:1465541-1465563 GGTCCCCCAGAGTGGACAAGTGG + Intergenic
969307016 4:6331683-6331705 GGTACCTCATGGTGGCAAAGTGG - Intronic
976084077 4:81389272-81389294 GATCTCAGATGGTGGCCAAAGGG - Intergenic
985023875 4:185720088-185720110 GGCTTCCCTTGGTGGTCAAGAGG - Intronic
987916909 5:24227024-24227046 TGTCTGCAATGGTGGACAAGGGG + Intergenic
988271505 5:29023385-29023407 GGGCTCCCTAGGTAGCCAAGAGG - Intergenic
991396969 5:66214164-66214186 GGTAGACCATGGTGGCAAAGGGG - Intergenic
998254660 5:140575431-140575453 GGACCCCCAAGGTGGCCAGGGGG - Intronic
998618415 5:143767423-143767445 TGTCATCCATGGTGGCAAAGTGG + Intergenic
999227835 5:150041977-150041999 GGTCCCTCACGGTGGCTAAGAGG - Intronic
1001845396 5:174917278-174917300 TGTACCCCATTGTGGCCAAGAGG - Intergenic
1002121049 5:177005266-177005288 GGTCTCCTATGTTGCCCAGGCGG + Intronic
1002407283 5:179044990-179045012 GGACTCCCCTCTTGGCCAAGGGG - Intergenic
1004250054 6:14016249-14016271 GGTCACCATGGGTGGCCAAGAGG + Intergenic
1004723563 6:18290148-18290170 CCTCTCCCATGGTGGCCAGGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1007399193 6:41594074-41594096 GGGCTCCCATGGTGGTGAGGGGG + Intronic
1007534372 6:42572080-42572102 TTTCTTCCCTGGTGGCCAAGTGG - Intronic
1007843939 6:44738770-44738792 GCTCTCACATGGAGGCCAAAGGG - Intergenic
1008769374 6:54960893-54960915 GTTCACCAATGGTGGCCATGGGG + Intergenic
1012546209 6:100422396-100422418 GGTTTGCCATGTTGGCCAGGCGG + Intronic
1013779444 6:113713918-113713940 GGTCTCCCATGGTAGCGTGGAGG - Intergenic
1014073497 6:117210587-117210609 GGTCACTCTTGGTGACCAAGTGG - Intergenic
1014256823 6:119169024-119169046 GTTTTACCATGTTGGCCAAGTGG - Intergenic
1015906544 6:138123205-138123227 AGTCCTCCATGGTAGCCAAGGGG - Intergenic
1022498379 7:30867194-30867216 GTTTTCCCAGGATGGCCAAGAGG - Intronic
1025231146 7:57203987-57204009 GGGGGCCCATAGTGGCCAAGGGG + Intergenic
1026726930 7:72877309-72877331 GGACTCCCCTGTTGGCCAACAGG + Intergenic
1026876372 7:73881375-73881397 GGTGTCCCAAGGTGGGCAAGAGG - Intergenic
1027116903 7:75488310-75488332 GGACTCCCCTGTTGGCCAACAGG - Intergenic
1027271106 7:76519428-76519450 TGGCACCCATGGTGGCCAAGGGG + Intergenic
1027274901 7:76547288-76547310 GGACTCCCCTGTTGGCCAACAGG + Intergenic
1027320869 7:77009363-77009385 TGGCACCCATGGTGGCCAAGGGG + Intergenic
1029720598 7:102361751-102361773 GGACTCCCCTGTTGGCCAACAGG + Intergenic
1030020110 7:105265472-105265494 GTTGTCCCTTGGTGTCCAAGGGG - Intronic
1033172985 7:139100633-139100655 TGCCTCACATAGTGGCCAAGTGG - Intronic
1034117827 7:148599961-148599983 GTCCTCCCAAAGTGGCCAAGGGG - Intronic
1034938236 7:155213533-155213555 GGTCCCTCATGGAGGCCCAGAGG + Intergenic
1037948763 8:23005422-23005444 GGTCTCCAAAGGTGTCCCAGAGG - Exonic
1039415869 8:37393676-37393698 CCCCTCCCATGGTGGCCCAGGGG - Intergenic
1039494891 8:37973347-37973369 GGTCTCCCTGGTTGGCAAAGTGG - Intergenic
1039643886 8:39257851-39257873 TATTTCCCATGGTGGGCAAGAGG - Intronic
1039918214 8:41875211-41875233 GGTCTCCTGTGGGGGACAAGAGG - Intronic
1041843532 8:62299455-62299477 GGACTCCCAGGGCGACCAAGAGG + Intronic
1042352325 8:67789859-67789881 GATGACCCATGGTGGCCCAGAGG + Intergenic
1046357078 8:113101292-113101314 GGTCTTACATGCTGTCCAAGAGG - Intronic
1047317205 8:123745609-123745631 GGACTAGGATGGTGGCCAAGGGG + Intergenic
1047403235 8:124563242-124563264 GGTCTCCGATGGTAACCATGTGG + Intronic
1049396965 8:142405368-142405390 GGTCTCACTGGTTGGCCAAGGGG - Intergenic
1059218623 9:112590668-112590690 GGTCTGCCATGGTTAGCAAGAGG - Intronic
1061400501 9:130365733-130365755 GGTCTCCCAGGCTGGGCAGGGGG + Intronic
1062580567 9:137227559-137227581 GGCCTCCCAGGGTGGCCTGGAGG + Exonic
1186290829 X:8096781-8096803 TGTCACACATTGTGGCCAAGAGG - Intergenic
1186726384 X:12363564-12363586 GGTCTCTGATGGTGGCTTAGGGG - Intronic
1191945464 X:66529995-66530017 GGTGTCCAATGGTGTCCAATAGG + Intergenic
1194011680 X:88569620-88569642 GGGCTCCCTGGGTAGCCAAGGGG - Intergenic
1197094282 X:122574764-122574786 GATCCCTCATGGTGGCCAACAGG + Intergenic
1197753240 X:129979900-129979922 GGTCGCCCAGGGTGGGGAAGTGG + Intergenic
1198653102 X:138885291-138885313 GGTCTCACCTTGAGGCCAAGGGG + Intronic