ID: 1127299020

View in Genome Browser
Species Human (GRCh38)
Location 15:57634430-57634452
Sequence CTGCAAACTCATATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127299020 Original CRISPR CTGCAAACTCATATGCAGCC AGG (reversed) Intronic
901148514 1:7084687-7084709 CCGCAAACACATATGCCTCCTGG - Intronic
902902811 1:19531684-19531706 CTGCAAACTCTCATGCAACCAGG + Intergenic
903340275 1:22649595-22649617 CCGCCAACTCATTTACAGCCTGG - Intergenic
903372733 1:22847359-22847381 CTGATAACTTATATGAAGCCTGG + Intronic
906025958 1:42674055-42674077 CTGTAGCCTCATATGCAGCATGG - Intronic
906818074 1:48899543-48899565 CAGCTACCTCATATGGAGCCTGG - Intronic
908725313 1:67169767-67169789 CTGCAAACTCAAATGTCTCCAGG + Intronic
911422334 1:97659323-97659345 CTGCCAATTTATAAGCAGCCTGG - Intronic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
912099541 1:106189160-106189182 CTACAAAGACATATGCAGCCGGG + Intergenic
912455611 1:109794829-109794851 CTGCCTCCTCATCTGCAGCCTGG - Intergenic
913178174 1:116294044-116294066 CTGCAAACTCAAATGCCTGCAGG - Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
915728952 1:158039163-158039185 ATGCAAAATCATAGGCAGGCTGG - Intronic
917177375 1:172251568-172251590 ATACACACACATATGCAGCCTGG - Intronic
921129129 1:212204633-212204655 TTGCAAACTCAAATGCCTCCAGG + Intergenic
923549760 1:234954291-234954313 CTGCAAACTCAGATGCCCACGGG + Intergenic
1066601154 10:37108396-37108418 CTGGAAACTCATAGGTAGGCAGG - Intergenic
1069281889 10:66664859-66664881 CAGCTGACTCATATTCAGCCAGG - Intronic
1072270772 10:93774206-93774228 TAGGAGACTCATATGCAGCCAGG - Intronic
1073959061 10:108904994-108905016 CTGCATCCTCTTATGCAGCTGGG - Intergenic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1077268359 11:1663495-1663517 CTGCCATCTCATCTGCATCCTGG + Intergenic
1077272520 11:1688123-1688145 CTGCCATCTCATCTGCATCCTGG - Intergenic
1077847620 11:6042693-6042715 GGGCAAACTCAGCTGCAGCCTGG - Intergenic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1079764895 11:24380138-24380160 CTGCAACCTCAGAGGCACCCTGG + Intergenic
1081734637 11:45394363-45394385 CTGGAACCTCAGAGGCAGCCAGG - Intergenic
1083089303 11:60183870-60183892 CAGTAAACTCATATGCAGGCTGG + Intronic
1083186434 11:61020417-61020439 GTGCACACACACATGCAGCCTGG - Intergenic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1085641202 11:78194025-78194047 CTACAAGCTCAGATGCGGCCGGG - Intronic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1086189062 11:84056553-84056575 GTGGAAACTCTTATGCACCCTGG - Intronic
1087200496 11:95339928-95339950 TTGTGAACTCATATGCTGCCAGG + Intergenic
1087637558 11:100719567-100719589 ATGCAAACACATTTGCATCCAGG + Intronic
1089405597 11:118194928-118194950 CTGCAAACTCAAAGGCTGGCAGG - Intronic
1091070324 11:132556996-132557018 TTGGAAACTCATTTTCAGCCAGG - Intronic
1091619992 12:2079832-2079854 CTGTAAGCTCATCTTCAGCCTGG - Intronic
1092014752 12:5149422-5149444 CTGGAAATTTATCTGCAGCCGGG + Intergenic
1092396996 12:8135453-8135475 CTCCACACTCAGATGCAACCAGG - Intronic
1099786311 12:87268629-87268651 CTGCAATCTCATCTGCAACTTGG + Intergenic
1100370398 12:93964357-93964379 CTGCAACTTCATATGAAACCTGG - Intergenic
1100575663 12:95889710-95889732 CTGCAAACTCAGATGGATACAGG + Intronic
1101547405 12:105729123-105729145 CTCCAACCTCACCTGCAGCCTGG - Intergenic
1102290501 12:111695397-111695419 CTCCAACCTCATTTGCAACCTGG + Intronic
1102394747 12:112575966-112575988 TTGCAAACTCAGATGCACACAGG + Intronic
1103436474 12:120930675-120930697 GTGCAAACTCAAATGCCTCCTGG + Intergenic
1104428729 12:128699074-128699096 CTGCAAACTCAAATGCCTACAGG + Intronic
1105292735 13:19062868-19062890 CTGGAAAGGCATCTGCAGCCTGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106730844 13:32539977-32539999 CTTAAAACTAATAAGCAGCCGGG + Intergenic
1108279787 13:48849997-48850019 CTGCAAAATCATCTGCGGCATGG + Intergenic
1109143468 13:58746646-58746668 CTGCAAACTGAAGTGCTGCCTGG + Intergenic
1110119646 13:71865959-71865981 CTGCAAACTCATCTCCAGGAAGG - Exonic
1110134004 13:72042970-72042992 CTGAACACTCATTTGCATCCTGG - Intergenic
1113163618 13:107411895-107411917 CTTCAAACTCCTAGCCAGCCTGG - Intronic
1113757289 13:112821907-112821929 CAGACAACCCATATGCAGCCTGG + Intronic
1114007392 14:18329987-18330009 CTAAAAACACATTTGCAGCCAGG - Intergenic
1114055707 14:18965690-18965712 CTGCAAAGCTTTATGCAGCCAGG - Intergenic
1114106840 14:19436074-19436096 CTGCAAAGCTTTATGCAGCCAGG + Intergenic
1115672311 14:35627930-35627952 GTGAAAACTCAAATGCAGCATGG - Exonic
1117067898 14:52028743-52028765 CTGCAAACTCATAACCACTCCGG + Exonic
1118492468 14:66274282-66274304 CAGCAAATTCTTATGCAGGCTGG + Intergenic
1118780853 14:69006569-69006591 CTGCAAAGTTAGAGGCAGCCCGG + Intergenic
1121647924 14:95534085-95534107 CTGGAAACTCAGAGGCGGCCGGG + Intronic
1122969218 14:105145700-105145722 CTGCAAGCTCAGATGCCACCAGG + Intronic
1123167989 14:106344694-106344716 CTGCAAACTCGTAGACATCCTGG + Intergenic
1123170628 14:106369407-106369429 CTGCAAACTCGTAGACATCCTGG + Intergenic
1123391314 15:19876653-19876675 CTAAAAACACATTTGCAGCCAGG - Intergenic
1125591501 15:40857209-40857231 CTCCAAACTCCTATGCAGGCAGG - Exonic
1127299020 15:57634430-57634452 CTGCAAACTCATATGCAGCCAGG - Intronic
1127540374 15:59932066-59932088 ATGCATACTCATATGCAGAGAGG + Intergenic
1128015932 15:64346751-64346773 CTGAAAACTCATTTCCAGCCAGG - Intronic
1129672846 15:77616634-77616656 CTGCAAATCCAAATCCAGCCTGG + Intronic
1129983858 15:79898534-79898556 ATGGAAACTCTTAAGCAGCCAGG + Intronic
1135332722 16:21574167-21574189 AGGCAAACTCATAGGCATCCAGG + Intergenic
1136027762 16:27480954-27480976 CTGCAAGGCCAAATGCAGCCAGG + Intronic
1137391407 16:48084343-48084365 CTACAAACTCATAGGGAGACAGG + Intronic
1138155483 16:54698977-54698999 AAGCAAACTCAGAAGCAGCCTGG + Intergenic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1141812701 16:86386438-86386460 CTGCAATGTCACTTGCAGCCTGG + Intergenic
1143274999 17:5703816-5703838 CTGCAAACTCACATACCTCCAGG - Intergenic
1144019701 17:11229407-11229429 CAGAGAACTCATTTGCAGCCAGG - Intergenic
1145211227 17:21014816-21014838 CAGGAAACTCACAAGCAGCCAGG + Intronic
1145835663 17:27952574-27952596 CTGCCTACTCCCATGCAGCCCGG + Intergenic
1154530080 18:15333954-15333976 CTAAAAACACATTTGCAGCCAGG + Intergenic
1158200651 18:54935685-54935707 TTGCAAACTCACATGCATGCTGG - Intronic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1160171941 18:76562496-76562518 CTGCAAACTCAACCGCAGTCAGG - Intergenic
1164064093 19:21699219-21699241 CTGCAAGCTGATAAGCAGGCTGG + Intergenic
1166703348 19:44894799-44894821 CTGCAAAGCCTTATGCAACCAGG - Intronic
927563868 2:24093910-24093932 CTACAAAGACACATGCAGCCAGG - Intronic
929071681 2:38037984-38038006 CTGCAAACCCCTCTGGAGCCTGG + Intronic
935920553 2:108008472-108008494 CTGGAAGCCCATATGCAGTCTGG - Exonic
938473878 2:131590290-131590312 CTGCAAAGCTTTATGCAGCCAGG - Intergenic
938529176 2:132165396-132165418 CTAAAAACACATTTGCAGCCAGG + Intronic
942570943 2:177313597-177313619 GTGAAAACTAATAGGCAGCCAGG - Intronic
943719524 2:191189180-191189202 GTGCAAACACATAAGCACCCGGG - Intergenic
944924566 2:204451275-204451297 CTGCAAACTCAAATGCCTTCAGG + Intergenic
1170003881 20:11645517-11645539 ATGCAAACTCTTGTGCAGGCTGG + Intergenic
1173162241 20:40661677-40661699 CATGAAAATCATATGCAGCCTGG - Intergenic
1176767331 21:13034520-13034542 CTAAAAACACATTTGCAGCCAGG - Intergenic
1177771911 21:25526442-25526464 CTGCAAAGTCAAGTGCAGCAGGG - Intergenic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1180431899 22:15260795-15260817 CTAAAAACACATTTGCAGCCAGG - Intergenic
1180474185 22:15688241-15688263 CTGCAAAGCTTTATGCAGCCAGG - Intergenic
1180856770 22:19052119-19052141 GTGAAAACACATTTGCAGCCAGG + Intronic
1181405250 22:22679845-22679867 CTTCAAAGTCATTTGCATCCTGG - Intergenic
1181429043 22:22866517-22866539 CTGCCAACTCATGAGCAGCTAGG - Intronic
1182794104 22:32977779-32977801 CTGGAAACTGACAAGCAGCCTGG + Intronic
1184682822 22:46081123-46081145 CAGCAAACTCATCGGCAGGCAGG + Intronic
956170361 3:66428937-66428959 CTGGAACGTCATCTGCAGCCAGG - Intronic
958675896 3:97268126-97268148 TTGCAAACAGATATGCTGCCTGG - Intronic
960104790 3:113783608-113783630 CAGCAAACTCATGTGGTGCCAGG + Intronic
961604189 3:128081706-128081728 CTGCAAACTTATATGTATACAGG + Intronic
964174385 3:153808059-153808081 CTAAAAATTTATATGCAGCCAGG + Intergenic
968733666 4:2284201-2284223 CTGAACACTCATTTGCAGGCTGG - Intronic
968912023 4:3481255-3481277 CTCCAAGCTCATCTGCACCCCGG - Intronic
979973166 4:127162893-127162915 CTGTAGAGTCATATGCACCCTGG - Intergenic
983674307 4:170273979-170274001 CTGGAAACTCATATGCATCCTGG + Intergenic
984483443 4:180335713-180335735 CTGCAAACTCAGAGGCAATCTGG - Intergenic
990173412 5:53080721-53080743 ATGGTAACTCCTATGCAGCCTGG + Intronic
990586845 5:57219645-57219667 CAGGAAACCCATATGCATCCAGG - Intronic
991471709 5:66975918-66975940 CTGCAACCTCATCTGCCTCCTGG - Intronic
992005081 5:72469748-72469770 ATGCAAAATCATCTGGAGCCTGG + Intronic
993237099 5:85325687-85325709 CTTCAAACACATATGCTTCCAGG + Intergenic
998929350 5:147163481-147163503 CTGCAGTCTCATGTGCAGCAGGG - Intergenic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1001445461 5:171779379-171779401 TTGCAAACTCAGATGCATACAGG - Intergenic
1002778573 6:349139-349161 CAGCAAGCTCAGGTGCAGCCAGG - Exonic
1005392831 6:25350541-25350563 CTGCAAACTCAAATGCCCACAGG - Intronic
1006272845 6:32977465-32977487 CAGCAAACTCCTGTGCATCCCGG - Exonic
1011005881 6:82645031-82645053 TTGGAAACTAAAATGCAGCCTGG - Intergenic
1012502032 6:99898774-99898796 CTGCATTCTCATCTGAAGCCTGG + Intergenic
1014394962 6:120916064-120916086 CTGCAAAATTATATGAAGCTTGG - Intergenic
1017040427 6:150304025-150304047 TTGCAAACTCATATGCCAACTGG - Intergenic
1017700111 6:157061225-157061247 ATGTAAATTCAAATGCAGCCAGG - Intronic
1019851006 7:3557361-3557383 CTGCAAACTAATACTCAACCAGG + Intronic
1026644809 7:72158368-72158390 ATGCAAACTCATCTCCTGCCTGG - Intronic
1031105555 7:117537898-117537920 CTGCAAACACATATATAGCAAGG + Intronic
1031404520 7:121368689-121368711 CTACAAGTTCCTATGCAGCCTGG + Intronic
1033372144 7:140718677-140718699 TTTAAAACTCATCTGCAGCCAGG - Intronic
1034434371 7:151056148-151056170 GTGCATACTCAGATGCGGCCAGG - Intronic
1036138563 8:6184397-6184419 CTCCATACTCACATGCAGCATGG - Intergenic
1040440276 8:47434314-47434336 CTGCACACTCACATGCATGCTGG + Intronic
1041815200 8:61962598-61962620 CTGCAAACTCATTTCCTCCCTGG + Intergenic
1044646688 8:94450941-94450963 CTGCAAACTAAAATGAACCCTGG + Intronic
1044652249 8:94508451-94508473 CTGCAAACTCGTATTCAACTTGG + Intronic
1048080227 8:131118730-131118752 CTGCAAAGTCCTCTGCAGCAAGG - Intergenic
1048458390 8:134599020-134599042 CTGGAAACTCATATGAAGTCGGG - Intronic
1049546503 8:143234148-143234170 CTGCACACTCATGTGCACCCAGG - Intergenic
1049823463 8:144651405-144651427 TTTTAAATTCATATGCAGCCGGG + Intergenic
1050101729 9:2127012-2127034 TTGCAAACTCATGTTCAGTCTGG + Intronic
1053707775 9:40771728-40771750 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054417685 9:64892512-64892534 CTAAAAACACATTTGCAGCCAGG + Intergenic
1058118733 9:101115068-101115090 CAGCAAAATCAAATGCAGTCTGG - Intronic
1058147776 9:101430776-101430798 CTACAGATTCATCTGCAGCCAGG + Exonic
1058493197 9:105524730-105524752 GTGAAAACTCAAATGCAGCATGG + Intronic
1058640578 9:107079758-107079780 TTGCTAAGTCATATGCAGGCTGG + Intergenic
1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG + Intergenic
1061563134 9:131419497-131419519 CTCCAGACTCCTATGCAGCCAGG - Intronic
1186809250 X:13171164-13171186 ATGCAAAGTCATGTGGAGCCAGG - Intergenic
1186811040 X:13188646-13188668 TTGCAAACTCAGATGCCTCCAGG - Intergenic
1189012514 X:37060670-37060692 CTGCATTCTAATATGCAGCAAGG + Intergenic
1198528887 X:137529653-137529675 CTGCATACTCATATGAAGGAAGG - Intergenic