ID: 1127299084

View in Genome Browser
Species Human (GRCh38)
Location 15:57634932-57634954
Sequence TAGGAGGACAATAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127299084_1127299091 20 Left 1127299084 15:57634932-57634954 CCTCCCACATTATTGTCCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1127299091 15:57634975-57634997 TAACTCAGATGCTCTCTCTCTGG 0: 1
1: 0
2: 3
3: 14
4: 167
1127299084_1127299093 28 Left 1127299084 15:57634932-57634954 CCTCCCACATTATTGTCCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1127299093 15:57634983-57635005 ATGCTCTCTCTCTGGGCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 411
1127299084_1127299092 21 Left 1127299084 15:57634932-57634954 CCTCCCACATTATTGTCCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1127299092 15:57634976-57634998 AACTCAGATGCTCTCTCTCTGGG 0: 1
1: 0
2: 2
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127299084 Original CRISPR TAGGAGGACAATAATGTGGG AGG (reversed) Intronic
907589421 1:55652044-55652066 GAGGAGGAGATTAATGTGAGAGG - Intergenic
907856163 1:58305994-58306016 GAGGAGGACTATAATGTGTGTGG - Intronic
908972025 1:69847709-69847731 AAGTAGGGCAACAATGTGGGAGG - Intronic
914245851 1:145885478-145885500 TAGGAGGACAAGAAAGGGGCCGG + Intronic
919665716 1:200289560-200289582 AAGAAGTACAATAATGTGGCTGG + Intergenic
919951389 1:202367507-202367529 AAGGAGGACACTAATGTGACTGG - Intronic
920998224 1:211015511-211015533 TGGGAGGAAAACAAGGTGGGGGG - Intronic
922702720 1:227771210-227771232 CAGGAGGTCAATATTTTGGGGGG + Intronic
923936830 1:238770931-238770953 AAGGAGGAAAATAATGGAGGGGG - Intergenic
1063087026 10:2829111-2829133 GAGGAGGACAAGAAAGTGAGTGG + Intergenic
1064136043 10:12751733-12751755 TAGAAAGACAAAAATGTGTGAGG + Intronic
1064338668 10:14467361-14467383 TAGGAGGCCAACACTTTGGGAGG + Intergenic
1068633139 10:59318862-59318884 TAGGAGCACACTAATGAGGAAGG + Intronic
1069138820 10:64798951-64798973 TAGAAAGAGAATAATGAGGGTGG - Intergenic
1070311783 10:75279095-75279117 TAGCAGGATGATCATGTGGGTGG - Intergenic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1077321007 11:1941974-1941996 TAGGAGGCCAAGAATGGTGGGGG + Intergenic
1077947104 11:6911721-6911743 TAAGAGGAAAGTAATGTAGGAGG - Intergenic
1082722212 11:56692122-56692144 TAGGGGGGCAATAATATTGGGGG - Intergenic
1088098535 11:106128774-106128796 AAGGAGGAATATACTGTGGGAGG + Intergenic
1089931498 11:122317853-122317875 TGGGAGGCCAAAAAGGTGGGCGG + Intergenic
1091978318 12:4844612-4844634 GAGGAGGAGAGTAATTTGGGTGG + Intronic
1096298988 12:50409299-50409321 ATTGAGGACAATAATATGGGAGG + Intronic
1096635129 12:52953307-52953329 TTGGAGGAAAAAACTGTGGGTGG - Intergenic
1098812864 12:75118392-75118414 AATGAAGACAATAAGGTGGGTGG + Intronic
1099604137 12:84780374-84780396 GAGGAGAACTATAATTTGGGGGG + Intergenic
1100317357 12:93457149-93457171 TTTGAGGAGAATAAGGTGGGAGG + Intergenic
1101522922 12:105501838-105501860 TAGAAGGACAAGTATTTGGGTGG + Intergenic
1103712118 12:122920383-122920405 AAGGTGGAAAATAATTTGGGTGG + Intergenic
1105446477 13:20461919-20461941 GAGGAGGACAACCTTGTGGGAGG + Intronic
1105604803 13:21918056-21918078 TAGGAGGTCAATAAAGGGAGAGG - Intergenic
1106466107 13:30015940-30015962 TAGGAGCACTAGAGTGTGGGTGG - Intergenic
1106863779 13:33940815-33940837 TATGATGGCAATAATGTGAGAGG - Intronic
1107572226 13:41674702-41674724 TAGTGGGACAATAATGAAGGAGG + Intronic
1108742405 13:53351781-53351803 TTGAAGGGCAATACTGTGGGTGG + Intergenic
1111810795 13:93093695-93093717 TAGGAACAAAATAATGGGGGGGG - Intergenic
1113259763 13:108548563-108548585 GAGGAGGATAATAATGATGGTGG + Intergenic
1114182410 14:20377825-20377847 AAGGAGGACTTTAATGGGGGTGG - Intronic
1122281602 14:100626145-100626167 GAGAAGGACAGGAATGTGGGGGG - Intergenic
1124054648 15:26231213-26231235 TAGGATTACAATAAGGTGGGAGG - Intergenic
1126366107 15:47896211-47896233 TGGGAGGAAAATAAAATGGGAGG - Intergenic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1128372510 15:67050578-67050600 GAGGAGGAAGATAATGTGTGGGG + Intergenic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1131816952 15:96231923-96231945 TAGGAGGAGGAGAAAGTGGGGGG + Intergenic
1133430293 16:5731083-5731105 TATGAGGACAATGATGTTGATGG - Intergenic
1135492792 16:22924359-22924381 TTGGAGGTCTCTAATGTGGGAGG - Intergenic
1137933415 16:52610007-52610029 TAGGACGAAAATAGAGTGGGGGG + Intergenic
1138066933 16:53951848-53951870 TAGAAATGCAATAATGTGGGTGG + Intronic
1139708847 16:68761145-68761167 CAGAAGGACAATAGTGTGGCTGG + Intronic
1141511430 16:84514566-84514588 TGGGATGAAAATAATGGGGGTGG + Intronic
1145911234 17:28544456-28544478 AATGAGGACAAGAATGTGGAAGG - Intronic
1146241690 17:31234782-31234804 AAGGATTACAATAATGTGGTAGG - Intronic
1150999095 17:70352592-70352614 GAGGAGGAGAGTAAGGTGGGTGG - Intergenic
1153550371 18:6256585-6256607 GAGCAGGACAAGAAAGTGGGGGG + Intronic
1157503906 18:48212549-48212571 GGGGATGTCAATAATGTGGGAGG + Intronic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1160384544 18:78487025-78487047 TGGGAGAACATTAATGAGGGAGG + Intergenic
1161620746 19:5295679-5295701 TTGGAGGAGAATAAGGTCGGAGG - Intronic
1163351471 19:16778778-16778800 TGGGAGGCCAATACTTTGGGAGG - Intronic
1163631261 19:18419112-18419134 TGGGTGTACAACAATGTGGGTGG + Intronic
925522210 2:4759832-4759854 TTGGAGGATAATATTGTGAGAGG + Intergenic
928639928 2:33287613-33287635 TAGGAAGCCAATAATTTGGTGGG + Intronic
930388769 2:50733639-50733661 TATAAGGACACCAATGTGGGTGG + Intronic
931052720 2:58431732-58431754 TCGGAGGGCAAGATTGTGGGAGG + Intergenic
940815498 2:158293204-158293226 TAGGAAGACAATATGGGGGGTGG + Intronic
944365882 2:198919163-198919185 CAGGAGCAAAATAATGTGGGTGG - Intergenic
945211594 2:207388988-207389010 CAGGAGGAATATTATGTGGGAGG + Intergenic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948051198 2:234980708-234980730 AAGGCGGACAATATTGAGGGAGG - Intronic
1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG + Intronic
1172417923 20:34787172-34787194 TTGGAGGACAATAAGATTGGAGG - Intronic
1174305067 20:49609236-49609258 GAGGAGGACACTGATGTTGGAGG - Intergenic
1179111365 21:38448702-38448724 TGGGAGGACAAAGATGTGGCAGG - Intronic
1179615244 21:42579344-42579366 CAAGAGGACCATAATGCGGGTGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1184014825 22:41778060-41778082 TAGGAGGTCAAGGCTGTGGGGGG - Intronic
949094151 3:65813-65835 TAGTAGGACTATAATTTGTGAGG + Intergenic
950901700 3:16503767-16503789 GAGGAGGACAGAAATGTAGGAGG - Intronic
951469337 3:23038820-23038842 TAGGTGGAAAATAATTTGGCTGG - Intergenic
951913054 3:27771235-27771257 AAAGAGTACAATAATGTGTGCGG + Intergenic
952542424 3:34380256-34380278 TAGGAGGTCAATAGTGAGGGAGG + Intergenic
952610504 3:35203253-35203275 TGGGTGGACAAGAATTTGGGTGG - Intergenic
953223614 3:40997362-40997384 CAGGAGGTCAGCAATGTGGGTGG + Intergenic
956449479 3:69359203-69359225 TAGGAGGAAAATAAAGCAGGAGG + Intronic
956914312 3:73854964-73854986 CAGGAGGACTATCATGTGGCTGG - Intergenic
957309721 3:78504446-78504468 TAGAAGGAAAAAAATGAGGGAGG + Intergenic
959433076 3:106278745-106278767 GAGGAAGACAATCATGGGGGAGG + Intergenic
960456905 3:117883389-117883411 TATGTGGACAATAATGTGAAAGG - Intergenic
961817256 3:129557444-129557466 TGTTAGGACAATGATGTGGGTGG + Intronic
961985603 3:131129873-131129895 AAGGAGAACAACAATGTTGGAGG - Intronic
964512309 3:157466197-157466219 TAGGAGCAAAAAAAAGTGGGGGG + Intronic
964650020 3:159000540-159000562 TGTGATGATAATAATGTGGGAGG + Intronic
964978997 3:162655562-162655584 TAGGAGACAAATAATGGGGGTGG - Intergenic
966219502 3:177536274-177536296 TAGGAGGACAAAGATGAGGCTGG - Intergenic
968935896 4:3610218-3610240 TGGGTGGACATTAAGGTGGGTGG - Intergenic
969334483 4:6499531-6499553 GGGAAGGACAAGAATGTGGGAGG - Intronic
970748694 4:19331792-19331814 TAGCTGAATAATAATGTGGGTGG - Intergenic
970879561 4:20912866-20912888 AAGGAGGACAATTATTTGTGTGG + Intronic
972539752 4:40029077-40029099 TAAAAGTACAAAAATGTGGGAGG + Intergenic
974874389 4:67685542-67685564 TATGAGGACAAAAATTTGGGGGG + Intronic
975337181 4:73192149-73192171 GAGGAAGACAATAAATTGGGGGG - Intronic
976325025 4:83761810-83761832 TAGTAGGACAATAATAAGGTAGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980796544 4:137691559-137691581 TAGGAAGACAAAAATTTGGTGGG + Intergenic
981699908 4:147597093-147597115 TAGGAGGAGATTGATGGGGGCGG - Intergenic
982612548 4:157594539-157594561 TAAGAGGACAATAATGTTTTAGG - Intergenic
986295209 5:6431921-6431943 TAGGAGGACACTAAGGAGAGAGG - Intergenic
987733699 5:21810274-21810296 TTGGAGGAAAATAACGTGTGAGG + Intronic
988389683 5:30611767-30611789 CAGGTGGACATTAATTTGGGTGG - Intergenic
988395377 5:30691136-30691158 TAGAAGGGAAATGATGTGGGCGG - Intergenic
994355547 5:98790514-98790536 GCAGAGGACAATACTGTGGGAGG + Intronic
994474677 5:100251507-100251529 TAGAAGGAAAAAACTGTGGGAGG - Intergenic
994802255 5:104393872-104393894 TAGAAGGACAAGAATGGGGCAGG + Intergenic
995773706 5:115701167-115701189 GAGAAGGACATAAATGTGGGGGG + Intergenic
1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG + Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006380549 6:33694843-33694865 TAGAAAAACAGTAATGTGGGGGG - Intronic
1007076152 6:39067669-39067691 GAGGAGGACAGGAATTTGGGGGG - Intronic
1007892934 6:45312666-45312688 CAGCAACACAATAATGTGGGGGG + Intronic
1010709407 6:79155112-79155134 TAGCAGGAAAATAATATGGGAGG - Intergenic
1016295510 6:142569182-142569204 AAGGAAGACTATAATGTGGTTGG - Intergenic
1018271202 6:162079686-162079708 GAGGGTGACAATAAGGTGGGTGG - Intronic
1018382863 6:163275356-163275378 TAAGATGAAAACAATGTGGGTGG - Intronic
1019138680 6:169929336-169929358 TAGGAGGTCAATAGTGAGGATGG + Intergenic
1019294784 7:267946-267968 TGGGAGGACATGAATGTTGGGGG + Intergenic
1020433820 7:8140818-8140840 TAGGAGGAGAAGCAAGTGGGTGG + Intronic
1020643422 7:10784538-10784560 TAGGAAGAAAATAAAATGGGAGG + Intergenic
1021667156 7:22995408-22995430 TAGGAAGAAAATATTGTAGGAGG - Intronic
1023007245 7:35885091-35885113 TGGGAGGAGCATGATGTGGGAGG - Intronic
1023393130 7:39729590-39729612 TGGGAGGCCAAGAAGGTGGGAGG + Intergenic
1024218597 7:47269152-47269174 GAGGAGGATATTAATTTGGGGGG - Intergenic
1026375504 7:69746561-69746583 TAGGAGAACATTAGTCTGGGTGG + Intronic
1026656823 7:72263878-72263900 CAGGAGGACATTAATTTGGGGGG - Intronic
1028124289 7:87094137-87094159 TAGAATGACATTAATGAGGGTGG - Intergenic
1029470211 7:100749751-100749773 TAAAAAGACAATAATGAGGGTGG + Intronic
1030687820 7:112504799-112504821 TAGGAGGACAAGAAGATGGGAGG + Intergenic
1030688678 7:112510971-112510993 AAAGAGGAAAATGATGTGGGTGG + Intergenic
1032349930 7:131152211-131152233 TACCAGGAGAATAAGGTGGGAGG + Intronic
1032627912 7:133612674-133612696 TAGGAGGCCAGTAATGCAGGAGG + Intronic
1034730471 7:153382665-153382687 CAGAAGGACAGTAATATGGGTGG + Intergenic
1037609923 8:20467360-20467382 TAGGAGGAAAGTAAGGTGGGAGG - Intergenic
1040495785 8:47964274-47964296 TAGAAGGAAAATAAAGTGTGAGG + Intronic
1044899364 8:96927500-96927522 CAGGAGCACAATAATGTGAATGG - Intronic
1049443076 8:142618010-142618032 TATGAAGACAGTGATGTGGGGGG - Intergenic
1050337341 9:4602173-4602195 TATGTGGACATTGATGTGGGGGG - Intronic
1054454324 9:65421783-65421805 TGGGTGGACATTAAGGTGGGTGG + Intergenic
1058169350 9:101661039-101661061 TAGGAGGGGAATAAACTGGGTGG + Intronic
1062628606 9:137453913-137453935 GAGGAGGAAGCTAATGTGGGTGG + Intronic
1185575506 X:1169081-1169103 TAGGAGGAGAGGAAGGTGGGAGG + Intergenic
1185773526 X:2784104-2784126 TAGCAGGAGAAAAAGGTGGGTGG - Intronic
1188785611 X:34342654-34342676 TAGCAGGAAAATAATGTGACAGG + Intergenic
1189219003 X:39354959-39354981 TAGGAGCACAGAAATTTGGGAGG - Intergenic
1195903120 X:109818877-109818899 TAGGAGGACACTAGTGTGACAGG + Intergenic
1196632821 X:117963190-117963212 TAGCATGACATAAATGTGGGGGG + Intronic
1196911305 X:120487169-120487191 TAGAAGGAGAGTAATTTGGGGGG + Intergenic
1197228565 X:123978455-123978477 TCAGTGGACAATAATGTGAGTGG + Intronic
1198381770 X:136090808-136090830 AAGAAGAACAATAAGGTGGGAGG + Intergenic