ID: 1127300232

View in Genome Browser
Species Human (GRCh38)
Location 15:57645753-57645775
Sequence TGGCCAACAAGACTCCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127300232_1127300234 -9 Left 1127300232 15:57645753-57645775 CCCTTTGGGAGTCTTGTTGGCCA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1127300234 15:57645767-57645789 TGTTGGCCACATTCAATCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 114
1127300232_1127300235 -8 Left 1127300232 15:57645753-57645775 CCCTTTGGGAGTCTTGTTGGCCA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1127300235 15:57645768-57645790 GTTGGCCACATTCAATCTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127300232 Original CRISPR TGGCCAACAAGACTCCCAAA GGG (reversed) Intronic
904681458 1:32232225-32232247 TGCCCACCCAGACTCCCAGAGGG - Intergenic
905612232 1:39363907-39363929 TGGCCAACAAGACTCATACGTGG + Intronic
912420788 1:109540940-109540962 TGGACATCAAGAGTCCCAGACGG - Intronic
913264220 1:117028492-117028514 TAGACATCAAGACTGCCAAATGG + Intronic
913687499 1:121246800-121246822 TGACCAACCATCCTCCCAAAAGG - Intronic
914039361 1:144034445-144034467 TGACCAACCATCCTCCCAAAAGG - Intergenic
914150098 1:145033491-145033513 TGACCAACCATCCTCCCAAAAGG + Intronic
919472580 1:197997609-197997631 GGGCCTACAAGACTGTCAAATGG - Intergenic
920474827 1:206265320-206265342 TGACCAACCATCCTCCCAAAAGG - Intronic
923890079 1:238204354-238204376 TTGCTAACCAGACTCCCATACGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1073084214 10:100878075-100878097 TGGTCAACCAGACTCCCAGATGG + Intergenic
1073094784 10:100972874-100972896 AGACTAACAAGACCCCCAAAGGG - Exonic
1075222621 10:120598383-120598405 TTGCCAAACAGACTCCCAGAGGG + Exonic
1079992243 11:27258411-27258433 TGGCCAACATGACTCTCATTAGG + Intergenic
1080498758 11:32848302-32848324 TGACCTAAAAGCCTCCCAAAAGG + Intronic
1083988779 11:66233883-66233905 TGGCCAACAAGACCTCCGACTGG + Exonic
1092329381 12:7568652-7568674 TGGCCAACAAGTGTAGCAAAAGG + Intergenic
1097046664 12:56191769-56191791 TGTCCAAAAGGAATCCCAAAGGG + Intergenic
1099879726 12:88453962-88453984 TGGCTAATAACACTTCCAAATGG - Intergenic
1100658136 12:96668665-96668687 TGGCCAAAAACATTCCAAAAGGG - Intronic
1100814313 12:98371349-98371371 AGGCCAACAAGCCTCCAAACAGG - Intergenic
1105651481 13:22383070-22383092 TGATGAATAAGACTCCCAAATGG - Intergenic
1107026369 13:35805594-35805616 TGGCCCACAACACTTTCAAAAGG + Intronic
1107560405 13:41552492-41552514 TGCCCAGAAAGTCTCCCAAAAGG - Intergenic
1110358635 13:74599118-74599140 TGCCCATCAAGACACCCTAAAGG + Intergenic
1110424371 13:75349645-75349667 TGGCAGACAAAACTTCCAAAAGG - Intronic
1111220407 13:85197637-85197659 TGACCATCAAGCCTCCCAGATGG - Intergenic
1111426977 13:88098354-88098376 TGGCCAAAAAGACTTCTAAATGG + Intergenic
1122697655 14:103564299-103564321 TTGCCAACCAGACACCCAAGTGG + Intronic
1127300232 15:57645753-57645775 TGGCCAACAAGACTCCCAAAGGG - Intronic
1127543361 15:59965480-59965502 TTGCCACCAAGAATTCCAAATGG + Intergenic
1131943012 15:97587599-97587621 TGGCCAACAGGTCTACGAAAAGG + Intergenic
1132137689 15:99359421-99359443 TGGCCAGCAAGGCTAACAAAAGG + Intronic
1132141343 15:99399218-99399240 TGGCCACAAAAACTCCCCAAAGG - Intergenic
1132237541 15:100233395-100233417 TGGTCAACAGGAGTCACAAACGG + Intronic
1133283490 16:4680069-4680091 TGGCCAGCAAGAAACCTAAAAGG + Exonic
1135412756 16:22247580-22247602 TGGCCAAGAAGAATCGCAACAGG + Intronic
1138266247 16:55661858-55661880 TGGCCACAAGGGCTCCCAAAGGG - Intronic
1139970539 16:70771396-70771418 GGGCCAACAAGACCCACAAGGGG - Intronic
1142772428 17:2108251-2108273 TGGCTAAGAAGACTCCAAAGAGG - Intronic
1150529924 17:65966595-65966617 TGGAAAACAAGACTCACAAGCGG + Intronic
1152896893 17:82916901-82916923 TGGGTAATAAGAGTCCCAAAAGG - Intronic
1155080110 18:22400993-22401015 TTGCCAAACAGATTCCCAAAGGG - Intergenic
1155365008 18:25041175-25041197 TGGCCGACAAGTCTCCGAAGTGG + Intergenic
1156265134 18:35481076-35481098 TGGCCAACTAGACCCTTAAAGGG - Intronic
1157676682 18:49573803-49573825 TGACCAACAAGAGTCCTGAAAGG - Intronic
1161502123 19:4622152-4622174 TGCCCTCCAAGACTCCCAAGAGG + Intergenic
928713794 2:34036895-34036917 AGGCCCATAAGACTGCCAAAGGG - Intergenic
929031858 2:37656907-37656929 TTGTCAACAAGAATCTCAAAAGG + Intronic
930122333 2:47770118-47770140 TGGCCTAAACGCCTCCCAAAAGG - Intronic
931754881 2:65364049-65364071 TGGCCACCAAAACTATCAAATGG + Intronic
931970622 2:67581861-67581883 GGGCCTACAAGAGTCACAAAGGG - Intergenic
932223381 2:70019141-70019163 TGGCCAACAGGAATCTGAAAAGG + Intergenic
935796405 2:106645419-106645441 TGGCCCACAACAGTCCCCAAGGG + Intergenic
941027301 2:160471122-160471144 TGTCCAAAATAACTCCCAAATGG - Intronic
944756372 2:202766117-202766139 TTGCCAACATGATTCCTAAAGGG + Exonic
947308264 2:228771975-228771997 TGGCTAACAAGAATCCCAAAAGG + Intergenic
1172740144 20:37160251-37160273 TGGCCAGCAAGAACCACAAAAGG + Intronic
1176206306 20:63890248-63890270 GGGCTAACATGATTCCCAAAGGG - Exonic
1176955592 21:15099439-15099461 TGGCCAACAAGAATAACAATAGG - Intergenic
1177796444 21:25783464-25783486 TGGATAACAAGAGTCACAAAAGG + Intergenic
1177821650 21:26036701-26036723 TGGGTAAGAAGATTCCCAAATGG + Intronic
1181922731 22:26333343-26333365 TGGCCAACAAGAAGCCCTAGAGG + Intronic
1181991614 22:26841345-26841367 TGGCTAAAAAGACACCCAGAGGG + Intergenic
1182584752 22:31338379-31338401 TGGCAGCCAGGACTCCCAAAAGG + Intronic
955748126 3:62160290-62160312 TGCCCAACTAGACTCACAAAAGG - Intronic
955881437 3:63550849-63550871 TGGCCAAGAAGACCCCACAATGG + Intronic
958469685 3:94501375-94501397 TGGGCAACTAGATTTCCAAATGG + Intergenic
961523978 3:127484839-127484861 TGACCCACAAGACTCTCAGATGG - Intergenic
962320391 3:134385207-134385229 CCGCCACCAAGACACCCAAAAGG + Intergenic
969242924 4:5913044-5913066 TGGCCAACAAGGCCCCAAGATGG + Intronic
969592068 4:8127681-8127703 TGGCCCACAGGGCTCCCACAAGG + Intronic
971606694 4:28667137-28667159 TGTCCAACAACATTTCCAAATGG - Intergenic
989540766 5:42616071-42616093 TGGCCACCAAGATCCCCAAGTGG - Intronic
994131942 5:96239597-96239619 AGGACAAAAAGACTCCCTAAGGG - Intergenic
996266079 5:121542212-121542234 TGGCCAGTAAGTCTCCAAAAAGG + Intergenic
996338768 5:122413192-122413214 TGGCCAATAAAATCCCCAAATGG + Intronic
998561248 5:143173706-143173728 TGGACAAAAAAGCTCCCAAATGG - Intronic
999334950 5:150707433-150707455 GGGCCCACAAGCCTCCTAAAAGG + Intergenic
1000879029 5:166675626-166675648 GGGCCTCCAAGACTTCCAAATGG - Intergenic
1002153323 5:177254651-177254673 TGGCCTCCCAAACTCCCAAAGGG + Intronic
1004764297 6:18708266-18708288 TGGCCAAGAAGGATGCCAAAAGG - Intergenic
1006382491 6:33707966-33707988 TGGACCACAAGACTCCCCAGAGG + Intronic
1010639364 6:78304487-78304509 TGGCAAACAAGAGTATCAAAAGG - Intergenic
1013978512 6:116102966-116102988 GGGCCAAAAAGACTTCCTAAGGG - Intronic
1020838597 7:13185460-13185482 TGACCAACAAGGCCCCCAAGAGG + Intergenic
1025199417 7:56952522-56952544 TGGCCAACAAGACCCCCCCTTGG - Intergenic
1025672531 7:63624411-63624433 TGGCCAACAAGACCCCCCCTTGG + Intergenic
1026535036 7:71232331-71232353 TGACCACCAAGGCTCCCAAAAGG - Intronic
1029011352 7:97264932-97264954 TGGCTACCAATACACCCAAAAGG + Intergenic
1029011668 7:97268610-97268632 CGGACAACAAGAATGCCAAATGG + Intergenic
1033504659 7:141987715-141987737 TTGCCACCAAGTCTCCCAAACGG - Intronic
1038054458 8:23845116-23845138 TAGCCAACACGAGTCCCTAATGG + Intronic
1038874016 8:31528183-31528205 ATGCCAACAAGAGTCCCTAATGG + Intergenic
1038894943 8:31772099-31772121 TGTGCATCAAGACTCACAAATGG - Intronic
1039689339 8:39847085-39847107 GTGCCAACAAGCCTCCCAATGGG + Intergenic
1044928599 8:97230604-97230626 TGGCCTAAACGTCTCCCAAAAGG - Intergenic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1047011603 8:120678902-120678924 TGGCCAACCAGAAGCCCCAAAGG + Intronic
1051112961 9:13661023-13661045 TGGCAGACAGGACTCCCGAATGG - Intergenic
1055981047 9:82001126-82001148 TTGCTAATAAGCCTCCCAAAAGG - Intergenic
1186487240 X:9942853-9942875 AGGCCAACAAGAATCTCAACAGG - Intronic
1189026999 X:37405863-37405885 TGGCAGACAAAAATCCCAAAAGG - Intronic
1189453156 X:41158565-41158587 TGGCTTACAAGACACCCTAAAGG + Intronic
1193632945 X:83912055-83912077 TGGCCAACAAGCCTGCCACCAGG - Intergenic
1196378104 X:115057797-115057819 AGGGCAACAAGATTCCAAAAGGG + Intergenic
1196413247 X:115442618-115442640 TGGTAAACAAATCTCCCAAAAGG + Intergenic
1199591173 X:149469672-149469694 TTGCCAAGCAGACCCCCAAAAGG + Intergenic
1199980362 X:152917341-152917363 AGGCCAACGGGACTCCAAAAAGG + Exonic
1201862961 Y:18619412-18619434 TAAGAAACAAGACTCCCAAAGGG + Intergenic
1201870362 Y:18700966-18700988 TAAGAAACAAGACTCCCAAAGGG - Intergenic
1202086225 Y:21139693-21139715 GGGCCAACAAGGCTCCCAGTGGG - Intergenic