ID: 1127300428

View in Genome Browser
Species Human (GRCh38)
Location 15:57647724-57647746
Sequence ACACCTCCTGCACTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127300419_1127300428 25 Left 1127300419 15:57647676-57647698 CCTAGAGTACTGCATAGCCTGAG 0: 1
1: 0
2: 2
3: 11
4: 100
Right 1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 232
1127300421_1127300428 8 Left 1127300421 15:57647693-57647715 CCTGAGAGTGCCTCCTAAGTGGA 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 232
1127300422_1127300428 -2 Left 1127300422 15:57647703-57647725 CCTCCTAAGTGGATGCCCTCCAC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 232
1127300423_1127300428 -5 Left 1127300423 15:57647706-57647728 CCTAAGTGGATGCCCTCCACACC 0: 1
1: 0
2: 1
3: 24
4: 153
Right 1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127300428 Original CRISPR ACACCTCCTGCACTTGGCCC TGG Intronic
900965209 1:5952696-5952718 ACACCTCCTGGAAGTGGTCCTGG + Exonic
902214704 1:14927034-14927056 GCACCTCCTGCTCTAGTCCCTGG - Intronic
902451781 1:16500926-16500948 AGCCCTCCTGCAGTTGGGCCAGG - Intergenic
902501167 1:16912739-16912761 AGCCCTCCTGCAGTTGGGCCAGG + Intronic
903207664 1:21795068-21795090 ACGCCTCCTGCAGCAGGCCCGGG - Intergenic
904094216 1:27965236-27965258 AGACTGTCTGCACTTGGCCCTGG - Intronic
905434811 1:37949005-37949027 AAACCCCCTGCACTGGGCCCTGG - Intergenic
906249541 1:44300724-44300746 CCCCCTCCTGCACATGTCCCCGG - Intronic
907930081 1:58990924-58990946 ACACCTCCTGACCAGGGCCCTGG + Intergenic
915607045 1:156958986-156959008 TCACCTCCGCCTCTTGGCCCTGG - Intronic
915939398 1:160109346-160109368 AGGCCCCCTCCACTTGGCCCAGG - Intergenic
916727372 1:167535080-167535102 GCACTTGCTGCACGTGGCCCTGG - Intronic
917717676 1:177754459-177754481 TTACCTCCTGCACTGGGCACTGG + Intergenic
918116600 1:181503327-181503349 ACCCCTCCTGTTCTTAGCCCTGG + Intronic
922696537 1:227733751-227733773 ACCCCTCCTTCAGTTGGACCAGG - Intronic
1063482351 10:6386678-6386700 ACACCTCCTACCCCAGGCCCGGG - Intergenic
1064247217 10:13678525-13678547 ACATCTCCAGCACTTTGCACTGG + Intronic
1065070275 10:22016172-22016194 CCAAGTCCTTCACTTGGCCCCGG - Intergenic
1065109047 10:22422194-22422216 ACACCTCTTCCAGTTGGCCCTGG - Intronic
1069654585 10:70078369-70078391 TCTCCTCCTCCACGTGGCCCAGG - Intronic
1069836666 10:71313544-71313566 CTTCCTCCTCCACTTGGCCCAGG - Intergenic
1070800088 10:79240052-79240074 ACTCCTCCTGCCGTGGGCCCTGG - Intronic
1071598216 10:86943070-86943092 CCAGCGCCTGCACTTGGCTCCGG + Exonic
1072036740 10:91569808-91569830 TCACCTCCTGCTCTGGGCCTTGG - Intergenic
1073471669 10:103726302-103726324 AGACTTACTGTACTTGGCCCAGG - Intronic
1076427018 10:130374036-130374058 GCACCTACTGCCCTTTGCCCTGG + Intergenic
1076737128 10:132463908-132463930 CCACCTCCTGCCCTGGGACCTGG - Intergenic
1077041980 11:528872-528894 ACACAGCCGGCACTTGGCACCGG - Intergenic
1077525277 11:3060500-3060522 TCACCTGCTGCCCATGGCCCAGG - Intergenic
1078019278 11:7641771-7641793 ACTTCTCCTTCTCTTGGCCCTGG - Intronic
1083277520 11:61605605-61605627 CCACCTTCTGCACCTGCCCCAGG + Intergenic
1085639678 11:78185507-78185529 ACTCCTCCACCACTTAGCCCTGG - Intronic
1085862700 11:80253277-80253299 ACACCACCTGCACTCTGCACTGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1089492514 11:118892735-118892757 ACACCCCCTGCACTTGGAGCAGG + Intronic
1090476549 11:127027106-127027128 ACACCTCCTATACTTGGCTAGGG - Intergenic
1091085535 11:132718578-132718600 ACAGCTCCTGCACAAGGCGCTGG + Intronic
1091622695 12:2101397-2101419 GAGCCTCCTGCACTTTGCCCGGG - Intronic
1094830513 12:34298051-34298073 GCAGCCCCTGCACTGGGCCCTGG + Intergenic
1094833088 12:34309352-34309374 GCATCCCCTGCACTGGGCCCCGG + Intergenic
1094833752 12:34312673-34312695 GCAGAACCTGCACTTGGCCCGGG - Intergenic
1095097024 12:38154401-38154423 TCAGCCCCTGCACTGGGCCCGGG + Intergenic
1095098288 12:38159406-38159428 ACATCCCCTGCGCCTGGCCCTGG + Intergenic
1098268465 12:68746819-68746841 CCACCTCCTGCACTGGCCCCGGG + Intronic
1099283485 12:80684212-80684234 AAACCTCCTGCACTTCACCGCGG - Intergenic
1101362732 12:104043081-104043103 ATGCTTCCTGCACGTGGCCCGGG + Intronic
1104123152 12:125818534-125818556 TAACCTCCTGTGCTTGGCCCAGG - Intergenic
1104528636 12:129548246-129548268 ACACCTCCTTCACTCGGTGCTGG + Intronic
1110315822 13:74105053-74105075 ACTTCTGCTGTACTTGGCCCTGG - Intronic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1110841383 13:80147464-80147486 TCACCTCCTACACTTGACACAGG + Intergenic
1112005667 13:95251618-95251640 ATACCTCCTGAACTTAGGCCTGG + Intronic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1117497258 14:56318049-56318071 AAACCTGCTGCACATTGCCCTGG + Intergenic
1117950756 14:61080738-61080760 ACAGCTGCTGCACCGGGCCCTGG + Intronic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1121262156 14:92574212-92574234 AAACCTCCTGCACTTCACCATGG - Intronic
1121390641 14:93570537-93570559 CTTCCTCCTGCACATGGCCCAGG - Intronic
1122774221 14:104110145-104110167 CCACCACCTGCACCCGGCCCAGG - Intronic
1123116109 14:105894785-105894807 CCACCCCCTGCACCTGCCCCAGG - Intergenic
1123198907 14:106643011-106643033 ATACCACCTGGACTTGCCCCTGG + Intergenic
1202898314 14_GL000194v1_random:22399-22421 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1123475957 15:20592744-20592766 GCCCCTCCAGCACTTGGCTCAGG - Intergenic
1123642054 15:22407619-22407641 GCCCCTCCAGCACTTGGCTCAGG + Intergenic
1123744646 15:23310235-23310257 ACAGGACCAGCACTTGGCCCTGG + Intergenic
1125442844 15:39722017-39722039 TCACCTCCTGCTCTGGGGCCCGG - Intronic
1125743612 15:41984386-41984408 GCACCTGCTGCCCTTGGCCCGGG - Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127403118 15:58612300-58612322 ACAGCTCCTCAACTTGGCCAAGG - Intronic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1129194071 15:73953885-73953907 ACACACCCGGCATTTGGCCCTGG - Intergenic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1130386282 15:83415065-83415087 CCCCCTTCTGCACCTGGCCCTGG - Intergenic
1130687744 15:86053793-86053815 CCACATCCTCCACTTGCCCCTGG - Intergenic
1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG + Intergenic
1131260651 15:90885793-90885815 ACACTCCCAGCACTTTGCCCAGG - Intronic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1132932934 16:2468018-2468040 ACCCCGCCTGGACCTGGCCCAGG + Intergenic
1133233505 16:4377262-4377284 ACACCTCCTGCACCAGGCAGAGG + Intronic
1133317164 16:4892039-4892061 GCAGCTGCTGGACTTGGCCCAGG - Exonic
1133385625 16:5367921-5367943 ACACCTCATGCACTTGACCTTGG + Intergenic
1133870368 16:9680314-9680336 AAACCTCCTGCACTTCACCACGG + Intergenic
1135427275 16:22349376-22349398 TCAGCTCCTCCACTTGGCTCTGG + Exonic
1136068533 16:27774754-27774776 ACACCTGCTCCCCTTGGGCCCGG + Intronic
1138392333 16:56679206-56679228 CCAAAGCCTGCACTTGGCCCAGG - Intronic
1138655787 16:58490494-58490516 ACACCACCTGCAGTAGGGCCAGG - Intronic
1140408967 16:74730008-74730030 AAACCTCCTTCCCCTGGCCCTGG + Intronic
1141311343 16:82916232-82916254 TCACCTTCTACACTGGGCCCTGG - Intronic
1141624655 16:85254879-85254901 CCACCTCCAGCACTGGGACCTGG - Intergenic
1142265780 16:89063414-89063436 GCACCTCCAGCCCTTGGGCCAGG - Intergenic
1144728622 17:17514321-17514343 ATCCCCCCAGCACTTGGCCCAGG + Intronic
1144840359 17:18182332-18182354 TCACCTCCTGGCCTTTGCCCAGG - Intergenic
1146585569 17:34078777-34078799 ACCCCTCCTCCACTCAGCCCAGG + Intronic
1147443636 17:40462112-40462134 ACACCTCCACCACTTGCCCTTGG - Intergenic
1148461333 17:47840714-47840736 CCACCTCCTGCACCTCGTCCCGG + Exonic
1149695064 17:58610235-58610257 ACACCTCCTACATCTGGGCCAGG - Intronic
1150139097 17:62713683-62713705 AAACCTCGTTCATTTGGCCCTGG - Intronic
1151494517 17:74451399-74451421 ACTTCTTCTCCACTTGGCCCGGG - Intronic
1151797026 17:76353424-76353446 CCACCTCCTGCACCTGGGGCGGG - Intronic
1152317354 17:79588912-79588934 CCCCGTCCTGCACTTGGACCTGG + Intergenic
1152580755 17:81164721-81164743 CCACCCCCTGCCCTTGGGCCGGG + Intronic
1203162106 17_GL000205v2_random:62556-62578 TCAGCCCCTGCACATGGCCCCGG - Intergenic
1153123771 18:1764730-1764752 TCACCTCCTGCTCTGAGCCCTGG + Intergenic
1154475251 18:14748560-14748582 CCAGCTTCTGGACTTGGCCCCGG - Exonic
1155250963 18:23953003-23953025 ACACATCCTGCACCTGGAACTGG + Exonic
1155819962 18:30362427-30362449 ACGCCTCCTGCAGCAGGCCCAGG + Intergenic
1157529463 18:48409248-48409270 GCGCCTCCCGCACTTGGCTCCGG + Intronic
1157559769 18:48638024-48638046 CCACCTCCTGCAGTTGGGCAAGG - Intronic
1158436012 18:57435878-57435900 GCAGCTCCTGCTCATGGCCCGGG - Exonic
1161839007 19:6667378-6667400 ACACCTCCTTCCCTGGGGCCAGG + Intronic
1162253169 19:9464166-9464188 GCACTTCCTGAACATGGCCCTGG - Intergenic
1162386839 19:10365098-10365120 ATACCTCCTGCACTTTCCCCTGG + Intronic
1162421532 19:10568581-10568603 GCACCTCCTGCACGTCGCCCCGG + Exonic
1162478293 19:10913921-10913943 ACACCTCCTCCACCTTGCCCGGG - Exonic
1164404997 19:27936682-27936704 ACACCTGCTGCTCTAGGCCAGGG - Intergenic
1164520527 19:28975748-28975770 ACACCTCCTCCTCCTGGCCTCGG - Intergenic
1165403933 19:35618649-35618671 CCACCTCCTCCACCAGGCCCTGG - Exonic
1166095013 19:40532796-40532818 AGGCCTCCTGCACCTGGCACAGG - Intronic
1166654922 19:44603979-44604001 AAACCTCCTGCACTTCACCATGG - Intergenic
1166827613 19:45619173-45619195 ACAGCTCTTCCACATGGCCCTGG + Exonic
1202647933 1_KI270706v1_random:158307-158329 TCAGCCCCTGCACTGGGCCCCGG + Intergenic
928006960 2:27571197-27571219 ACACCTCCTGCCTGTGGCTCTGG - Intergenic
929924691 2:46198514-46198536 ACAACTCATGCACTGGGCCTTGG - Intergenic
931467709 2:62505999-62506021 ACACCCCCTGCACCGGGCCTCGG + Intronic
936484771 2:112916482-112916504 ACAAATCTTGCACCTGGCCCTGG - Intronic
937223532 2:120355474-120355496 CCAACTCCTGCCCTTGGCTCTGG + Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938489828 2:131755640-131755662 TCAGCCCCTGCACTGGGCCCCGG + Intronic
941962753 2:171269779-171269801 ACACCTCCTTCTCTTGACTCTGG - Intergenic
942452887 2:176119289-176119311 AGTCCTCCAGCACTGGGCCCTGG - Exonic
946412083 2:219520495-219520517 CCACCCCCTACACTTGGCCCTGG + Intronic
946528459 2:220545272-220545294 AAACATGCTGCACTTCGCCCTGG - Intergenic
946726813 2:222669899-222669921 ACAACTCCTCCAAGTGGCCCTGG + Intergenic
946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG + Intergenic
947924737 2:233911429-233911451 CCACCTCCTTCACTCGGTCCTGG + Intergenic
948593343 2:239064810-239064832 ACGCCTCCTGCACATGGGCGTGG - Intronic
948989929 2:241548554-241548576 ACCCTTCCTGCACTCGGCTCAGG + Intergenic
1172220671 20:33272652-33272674 CCACGTCCTTCACATGGCCCAGG - Intergenic
1172221991 20:33280454-33280476 ACACCTCCTGCCCTCCTCCCTGG + Intronic
1172271427 20:33657713-33657735 TCTCCTCCTGGACTTGGGCCTGG - Exonic
1174375653 20:50124932-50124954 ACATCTCCTGGGCTGGGCCCAGG - Exonic
1175586369 20:60143800-60143822 TGGCCTCCTGCACTAGGCCCTGG - Intergenic
1175770731 20:61622566-61622588 CCTCCTGCTGCACATGGCCCAGG + Intronic
1176603916 21:8814422-8814444 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1176618001 21:9038392-9038414 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1178847112 21:36183062-36183084 ACAGCTCCTGCACTCTGGCCTGG - Intronic
1179501514 21:41812187-41812209 ACACTTCCTGGTCTTGTCCCTGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1179583270 21:42358489-42358511 ACCCACCCTGCGCTTGGCCCCGG - Intergenic
1179888651 21:44325246-44325268 ACACCTGCTGCAGGTGGCCCAGG - Exonic
1180048388 21:45320259-45320281 CCTCCTCCTGCAGGTGGCCCAGG + Intergenic
1180346200 22:11705999-11706021 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1180789061 22:18564276-18564298 ACACCCCATGCACTTCTCCCTGG - Intergenic
1181048909 22:20229531-20229553 CCACCTCCTGCGGGTGGCCCTGG - Intergenic
1181232676 22:21431044-21431066 ACACCTCATGCACTTCTCCCTGG + Intronic
1181245975 22:21503812-21503834 ACACCTCATGCACTTCTCCCTGG - Intergenic
1181550028 22:23632553-23632575 ACTCCCCCTGCACTTAGCTCAGG - Intergenic
1181556956 22:23676708-23676730 ACACCTGCTGCAGGTGGGCCTGG + Intergenic
1181697415 22:24600828-24600850 ACACCTGCTGCAGGTGGGCCTGG - Intronic
1181848179 22:25730028-25730050 TCACCTCCTGCCCATGGACCTGG - Intergenic
1182099234 22:27646145-27646167 CCACCTACTTCACCTGGCCCTGG - Intergenic
1183706146 22:39476008-39476030 ACCCCTCCTGCACTGGTCACTGG - Intronic
1183978825 22:41528076-41528098 TCCCCTCCTGCACTGGCCCCAGG + Exonic
1184101992 22:42345572-42345594 CCACCTCCTGGACTTAGCTCTGG - Intergenic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1184776508 22:46626139-46626161 CCACCTGCTCCACCTGGCCCCGG - Intronic
1185382816 22:50517987-50518009 CCCCCTCCTGCCCATGGCCCTGG + Exonic
950398727 3:12753877-12753899 AGCCCTCCTGCCCTGGGCCCAGG - Intronic
950443187 3:13021775-13021797 ACACATGCTGCACCTGCCCCTGG + Intronic
952932278 3:38369515-38369537 ACTCCTCCTCCACTGGGCCAAGG - Intronic
952968578 3:38636674-38636696 CCACCACCTGCACCTGGCTCTGG + Intronic
955364456 3:58299415-58299437 ACTCCTCCTGCTCTTTTCCCTGG + Intergenic
956405424 3:68923785-68923807 ACTCCTCATGCATATGGCCCAGG - Intronic
956836748 3:73101998-73102020 ACACTTCCTGCAGCTGGCACTGG + Intergenic
957228881 3:77485800-77485822 ACACATCCTGCACATGGACCTGG - Intronic
959089940 3:101891017-101891039 TAGCCTCCTGCACTAGGCCCTGG - Intergenic
959520252 3:107316854-107316876 ATCCCTCCTGCCCTTGGCCTGGG - Intergenic
960239254 3:115321045-115321067 ACATTTCCTGCACTAAGCCCAGG - Intergenic
961329145 3:126128689-126128711 ACACATCCTGCCCTGGGGCCTGG - Intronic
961405162 3:126673121-126673143 ACACCTCTGGCAGCTGGCCCTGG - Intergenic
961861618 3:129921011-129921033 ACACACCCTGCACTTGGCTGTGG - Intergenic
966377230 3:179308719-179308741 GCACCTACTGCACTTGAGCCTGG + Intergenic
967379423 3:188840997-188841019 GTACCTCCTGCACTGGGACCCGG - Intronic
968046015 3:195624266-195624288 ACACCACCTGCAGTGGTCCCTGG - Intergenic
968308639 3:197665821-197665843 ACACCACCTGCAGTGGTCCCTGG + Intergenic
968898601 4:3419879-3419901 ACACATTCTGATCTTGGCCCAGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969467415 4:7366072-7366094 ACTCCTCCTGCATTTGCCTCTGG - Intronic
969652823 4:8477933-8477955 ACACCTCCTGAGCTAAGCCCAGG + Intronic
970461714 4:16281024-16281046 ACACCACCTCCCCTTGGCCAAGG + Intergenic
970548551 4:17155446-17155468 ACATCTCCTGCACTTCAACCAGG - Intergenic
970913607 4:21307402-21307424 AAACCTCCCTCACCTGGCCCTGG + Intronic
973701192 4:53538960-53538982 AGATCTCCTGGACTTGGCCATGG - Intronic
980306402 4:131065677-131065699 ACACCTCCTGCACTGCAGCCTGG + Intergenic
983666296 4:170188380-170188402 CCAACTCCTGCACCTAGCCCTGG - Intergenic
985747300 5:1654609-1654631 ACACCACCTGCAGTGGTCCCTGG + Intergenic
986043097 5:4012086-4012108 AGACCTCCTGTCCTAGGCCCAGG + Intergenic
990271886 5:54150959-54150981 ACACCTACAGCACTTTACCCAGG - Intronic
992408135 5:76479034-76479056 GCACCTCCTGAGCCTGGCCCAGG + Intronic
994151750 5:96455924-96455946 ATATCTCCAGCACCTGGCCCAGG + Intergenic
995881687 5:116850814-116850836 AAACCTCCTGCTCTTTGCCATGG - Intergenic
996920597 5:128763460-128763482 ACACCTCCTGCACACAGCCATGG - Intronic
1002581772 5:180212996-180213018 AGACCTCCTCCACATGCCCCTGG - Intergenic
1002663621 5:180807262-180807284 AGGCCTCCTGCCCTTTGCCCAGG + Intronic
1002860500 6:1075481-1075503 CCAGCTCCTGCACCTGCCCCTGG + Intergenic
1002882102 6:1262262-1262284 CCACCTCCTGCCCTAAGCCCTGG + Intergenic
1003638533 6:7857021-7857043 GCACCTCCTGCCCTTGTCCGAGG + Intronic
1005671225 6:28108067-28108089 GCACTTCCTGCACATGGGCCTGG - Intergenic
1007595057 6:43046136-43046158 CCACCCCCTGGACTTGGCCATGG - Intronic
1008060331 6:46990158-46990180 ACCCCTCCTCCACTTTGCCCAGG + Intergenic
1010780298 6:79938017-79938039 ACATCACCTGCACTTGGGCATGG - Intronic
1013345650 6:109257693-109257715 ACATGTCCTGCAGCTGGCCCTGG + Intergenic
1013506494 6:110805555-110805577 TCAGGTCCTGCAGTTGGCCCTGG + Intronic
1017444128 6:154492169-154492191 ACACCTCCTTCGCTTGCCTCTGG + Intronic
1018837175 6:167493975-167493997 ACACCCCCCGCACTAGGCCTTGG + Intergenic
1019387232 7:764173-764195 GCAGCTCTTCCACTTGGCCCGGG + Intronic
1020040083 7:4995360-4995382 AGACTGTCTGCACTTGGCCCTGG - Intronic
1020934803 7:14449472-14449494 ACACCCCCTACACTTGGAACAGG + Intronic
1026117552 7:67508816-67508838 AAACCTCCTGCATTTCACCCTGG - Intergenic
1028271071 7:88790290-88790312 GCACGTCCTGCACTTGTACCTGG - Intronic
1029939960 7:104469617-104469639 ACCCCACCTGGACTTAGCCCTGG + Intronic
1030157035 7:106465748-106465770 TCACCTGCTGCACTTGGCCTGGG + Intergenic
1032176774 7:129636061-129636083 ACCACTCCTGTACTTAGCCCTGG - Intronic
1034107611 7:148503673-148503695 AGACCACCTGGACTTGGCCTTGG - Intergenic
1034245764 7:149643223-149643245 CCACATCCTGCACCTTGCCCTGG - Intergenic
1034832198 7:154319034-154319056 ACACCTCCTGCTGCTGGCCCTGG - Intronic
1035311071 7:157969429-157969451 ACACATCCTGCACTTGTCAGTGG + Intronic
1037323710 8:17668133-17668155 TCACAGCCTGCACGTGGCCCAGG + Intronic
1038348621 8:26755765-26755787 CCACCCCCTGGACTTGGCGCTGG + Intronic
1038481092 8:27902288-27902310 CCACCCCCTCCACTTGGCCCTGG - Intronic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1040277390 8:46020986-46021008 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1048573803 8:135675760-135675782 ACACCTCCTGGGCTGAGCCCTGG + Intergenic
1049618221 8:143585691-143585713 CCAACTCCTGATCTTGGCCCGGG + Intronic
1050003947 9:1108326-1108348 CCACCCCCTGCAACTGGCCCTGG + Intergenic
1052038853 9:23715147-23715169 AAACCTCCTGCACAAGGCCATGG - Intronic
1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG + Intergenic
1053509790 9:38677996-38678018 ACCCCTCCAGCTCTTGGCCCAGG - Intergenic
1056222496 9:84464203-84464225 TCATCTCCTCCACCTGGCCCTGG + Intergenic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1059141898 9:111861285-111861307 AAATCTCCTGGACTTGGCCTTGG - Intergenic
1061007516 9:127936522-127936544 TCACCTCCTCCCCTTGACCCTGG - Intronic
1061415515 9:130445051-130445073 ACGCCTCCTCCTCTGGGCCCGGG - Intronic
1203453510 Un_GL000219v1:143697-143719 ACATCCCCTGCACTCGGGCCTGG - Intergenic
1187415856 X:19092731-19092753 ACAACTCCTGGACTAGGTCCTGG - Intronic
1189712337 X:43826454-43826476 GCATCTCCAGCACTTGGCTCAGG - Intronic
1189733355 X:44045113-44045135 TCACCTCTTGCCCTGGGCCCAGG - Intergenic
1191253388 X:58269704-58269726 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1191257964 X:58287941-58287963 ACAGCCACTGCACTGGGCCCAGG + Intergenic
1193583654 X:83294506-83294528 ACTCCTACTGCCCTTGGCCTCGG + Intergenic
1198087181 X:133292735-133292757 CCACCTCCTGCAGTGGGCACAGG - Intergenic
1200839609 Y:7767678-7767700 GCACCTACTGCACCTGGCCAGGG - Intergenic
1201151380 Y:11097227-11097249 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1201152403 Y:11101327-11101349 TCAGCCCCTGCACTGGGCCCAGG - Intergenic