ID: 1127300708

View in Genome Browser
Species Human (GRCh38)
Location 15:57650970-57650992
Sequence GTGATGAAGGACATCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127300708_1127300710 -1 Left 1127300708 15:57650970-57650992 CCAAGAAGGATGTCCTTCATCAC 0: 1
1: 0
2: 2
3: 2
4: 129
Right 1127300710 15:57650992-57651014 CTCTGCTCATAATTCCTCAATGG 0: 1
1: 0
2: 7
3: 47
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127300708 Original CRISPR GTGATGAAGGACATCCTTCT TGG (reversed) Intronic
901365041 1:8739626-8739648 GCAATGAAGGACATACTTCGAGG + Intronic
901853325 1:12029567-12029589 GTGGGGAGGGACATCCTCCTGGG - Intronic
904712592 1:32441805-32441827 CTGATGAAGGTCATCCTGTTGGG + Intergenic
914926125 1:151889679-151889701 GTAAAGACGGAAATCCTTCTTGG + Intronic
920987484 1:210904302-210904324 ATGTAGAAGAACATCCTTCTTGG + Intronic
923298316 1:232616435-232616457 GGGATGGAGGAGACCCTTCTGGG + Intergenic
1065907012 10:30264482-30264504 GTAATGAAGGACATCCAAATCGG + Intergenic
1067298063 10:44986262-44986284 GTGATGAATGAGACCCTTCGAGG - Intronic
1067365489 10:45624225-45624247 ATGTTGAAAGACATCTTTCTAGG + Intronic
1070840635 10:79485074-79485096 GTGATGAAGAACAAGCTTTTTGG + Intergenic
1076681199 10:132172287-132172309 GTGATGAAACACACCCATCTCGG - Intronic
1078056148 11:8010451-8010473 GTGGAGAGGGACATCCTCCTGGG - Intergenic
1078370677 11:10742121-10742143 TTCATGAAGGACATCTTGCTGGG - Intergenic
1078808180 11:14727951-14727973 GTGATGAAGAGCATGCTTATAGG + Intronic
1081855627 11:46301492-46301514 GTGATGGAGGGCATCATGCTGGG - Intronic
1085990922 11:81843268-81843290 ATGATGCAGGACATCGGTCTCGG - Intergenic
1087745784 11:101945197-101945219 GACATCAAGGACATCATTCTTGG + Intronic
1089978678 11:122754647-122754669 ATGATGAAGAACAGCCTTCAGGG - Intronic
1090088869 11:123676046-123676068 GTTGTGAAAGACATCCTCCTTGG - Intergenic
1093000677 12:13992841-13992863 TAGATGAAGGACATTCTACTAGG + Intergenic
1095987141 12:48005972-48005994 TTGTTGAAGGAAATGCTTCTAGG + Intergenic
1106739959 13:32630166-32630188 GTGATAATGTACATTCTTCTGGG - Intronic
1107415519 13:40196338-40196360 GGGATGGAGGAGATTCTTCTGGG + Intergenic
1109587558 13:64426650-64426672 TTGAAGAAGGACATCCAGCTTGG - Intergenic
1121063860 14:90942271-90942293 GTTATAAAAGACATCATTCTTGG - Intronic
1123151545 14:106186227-106186249 GTGATGCATGAGATCTTTCTTGG - Intergenic
1125976212 15:43954226-43954248 GTGATTCAGGACGTTCTTCTGGG + Intronic
1126589077 15:50321406-50321428 CTGATGAAAAACTTCCTTCTAGG + Intronic
1127300708 15:57650970-57650992 GTGATGAAGGACATCCTTCTTGG - Intronic
1130042348 15:80415548-80415570 GGAATGAAGGACATTCTTATTGG + Intronic
1132577430 16:670502-670524 GGGATGCAGGACGGCCTTCTGGG - Exonic
1134379682 16:13712329-13712351 GTTATGAAAGATTTCCTTCTGGG - Intergenic
1135900863 16:26458678-26458700 GTGAGGAAGGAGATGCTTTTGGG - Intergenic
1140193729 16:72839490-72839512 GAGATGGGGGACACCCTTCTTGG - Intronic
1142720665 17:1773733-1773755 GTGGCCAACGACATCCTTCTAGG + Intronic
1143766777 17:9143073-9143095 GGGATGAAGGGCAGCCGTCTGGG + Intronic
1145209598 17:21003413-21003435 GGGATAAAGGACAGCCTTCAGGG - Intronic
1145978681 17:28998747-28998769 GTGATGAAGGGCACCCATCATGG + Intronic
1145980669 17:29009506-29009528 GAGCTGAAGGACATCCTTGGTGG + Intronic
1146660146 17:34660096-34660118 GTAAGGAAGCACATCTTTCTGGG - Intergenic
1148698541 17:49575325-49575347 GTGCTGAGGGAAGTCCTTCTGGG - Intergenic
1148803419 17:50248965-50248987 ATGAACAAGGACATCCTCCTAGG + Intergenic
1149138217 17:53396235-53396257 TTGACTAAGGACATTCTTCTAGG + Intergenic
1152118121 17:78401280-78401302 GTGATGCAGGGCAGGCTTCTGGG - Intronic
1154976400 18:21461429-21461451 GTGAGGATGGACAGCCCTCTTGG - Intronic
1161642244 19:5431625-5431647 GTGATGAAGGTCGTCGTTGTTGG + Intergenic
1162052662 19:8044126-8044148 TGGATGAAGGTCACCCTTCTGGG + Intronic
1163939623 19:20479850-20479872 ATTCTGAAGGACAGCCTTCTAGG - Intergenic
1165269229 19:34690432-34690454 CATATGAAGCACATCCTTCTGGG + Intergenic
1165275648 19:34748757-34748779 CATATGAAGCACATCCTTCTAGG + Intergenic
928449167 2:31363485-31363507 ATGATGCAAGACATCATTCTGGG + Intronic
932306018 2:70704776-70704798 GTAATGAAGGACATTTTTTTAGG + Intronic
935261899 2:101362886-101362908 GGCAGGAAGGACATCCCTCTGGG - Intronic
936382967 2:112003996-112004018 GTGATGAATCCCATTCTTCTAGG + Intronic
937454421 2:122029059-122029081 GAGATGAAGGAGCTGCTTCTTGG + Intergenic
937481973 2:122271217-122271239 GTGAAATAGGACATCTTTCTAGG - Intergenic
940130771 2:150378938-150378960 GTGATCTTGGACATGCTTCTTGG + Intergenic
941652480 2:168107374-168107396 GTGAGGTTAGACATCCTTCTGGG - Intronic
942960931 2:181829280-181829302 GTAATGAAGGACATCTTTGTAGG - Intergenic
945850223 2:214997084-214997106 GTGATGCATGACCTCTTTCTGGG - Intronic
1169576349 20:6966251-6966273 GTGATGAATGACACCCTTAGGGG + Intergenic
1169972626 20:11285523-11285545 GTTTTGAAGGACAGCCTTCCTGG + Intergenic
1171397857 20:24850301-24850323 GTGAGGAAAGAGAGCCTTCTGGG - Intergenic
1171777393 20:29381886-29381908 GAGATGATACACATCCTTCTCGG - Intergenic
1181863379 22:25836416-25836438 GTGATGGAGAACATGATTCTGGG + Intronic
956341373 3:68227898-68227920 GTGATAAAAGATTTCCTTCTGGG - Intronic
957490291 3:80917489-80917511 GTTGTGAAGGACAGCCTGCTGGG + Intergenic
959542090 3:107551747-107551769 ATGATCAGGAACATCCTTCTGGG + Intronic
961405536 3:126677117-126677139 CTGATCAAGGTCATCCATCTGGG - Intergenic
965488179 3:169304484-169304506 GTGATGAAACACACCATTCTTGG + Intronic
966425663 3:179777381-179777403 GTTTTGCAGGACATCCTTGTGGG + Intronic
966926194 3:184646120-184646142 ATGAGGAAGGACTTTCTTCTGGG + Intronic
970056486 4:11979361-11979383 GAGATGATATACATCCTTCTCGG - Intergenic
971082621 4:23231935-23231957 GTGAAGAAGGACCTTCTTCCAGG + Intergenic
975242433 4:72076790-72076812 GTGATGAGGGACATTCTTGCTGG - Intronic
977272981 4:94940945-94940967 AGGTTGAAGGACATTCTTCTTGG + Intronic
978336896 4:107678940-107678962 GAGATGAAGGAAACCCTTTTGGG + Intronic
981739795 4:147989786-147989808 GAGATGATATACATCCTTCTCGG + Intronic
984220724 4:176971368-176971390 CAGATGAATGACACCCTTCTTGG + Intergenic
986346653 5:6841887-6841909 TTAATGAAGAACATCCTTCCAGG - Intergenic
989698983 5:44239361-44239383 GAGATGATATACATCCTTCTCGG - Intergenic
990178003 5:53128731-53128753 GTGGTGGATGACATCCTCCTAGG - Intergenic
994926647 5:106124565-106124587 ATGAAGAAGTACATGCTTCTAGG - Intergenic
995018346 5:107339037-107339059 GTGATGACGGGCATACTGCTAGG + Intergenic
997239648 5:132296916-132296938 GTGATGATGTACATCCTTAGAGG - Intronic
997642316 5:135457408-135457430 TTGCTCAAGGTCATCCTTCTGGG + Intergenic
997971421 5:138405660-138405682 GTAATGAAGAACATCCTACATGG + Intronic
1000028266 5:157378980-157379002 TTGATGAAAAACATCCTACTTGG + Intronic
1000546947 5:162614845-162614867 CTGATGTAGGACATTTTTCTGGG - Intergenic
1001603687 5:172945216-172945238 GTGATGAAGAACATCCTTGTGGG - Intronic
1002347488 5:178557979-178558001 GTGATGGAGGCCATCCTGGTAGG - Intronic
1002968141 6:1988440-1988462 GGGATGAAAGAGCTCCTTCTTGG + Intronic
1003829139 6:9987370-9987392 GGGAGTAAGGACATCTTTCTTGG - Intronic
1006983391 6:38162873-38162895 GTGATGGAGGACATCGGACTTGG + Intergenic
1013503642 6:110777017-110777039 GTGACGAAGAACATGTTTCTGGG - Intronic
1019622784 7:2000736-2000758 CTGCTTAAGGACATTCTTCTTGG - Intronic
1023133549 7:37027763-37027785 GTGCTGGAGGATATGCTTCTTGG - Intronic
1023169358 7:37375589-37375611 GGCATGGGGGACATCCTTCTTGG - Intronic
1023859555 7:44209653-44209675 GGGATGAAGGACATTCTTGCTGG + Intronic
1024169800 7:46772976-46772998 GAATTGAAGGACATCCTACTTGG - Intergenic
1024892885 7:54223574-54223596 GAGATGATATACATCCTTCTCGG + Intergenic
1025009696 7:55386171-55386193 GAGATGATATACATCCTTCTCGG + Intronic
1025576846 7:62655819-62655841 GTGATAAAGGAAATACTTTTTGG - Intergenic
1031485050 7:122315431-122315453 GGGACGCAGGACATCGTTCTAGG + Intergenic
1033946764 7:146728108-146728130 GAGACGGAGGACATCTTTCTGGG + Intronic
1035676207 8:1457762-1457784 GGGAGGAAGGGCAACCTTCTGGG - Intergenic
1035858414 8:3001875-3001897 GGGATTAAGTATATCCTTCTAGG + Intronic
1036600882 8:10259433-10259455 GTGGTAAAGGACATACTTCCTGG + Intronic
1037000553 8:13713398-13713420 CTGTTGAAGTACTTCCTTCTAGG + Intergenic
1037823665 8:22147977-22147999 GTGATGATGCACGTCCTCCTGGG + Exonic
1040732956 8:50471705-50471727 ATGTTGAATGACATCTTTCTTGG - Intronic
1040894781 8:52354810-52354832 CTGTTGAAGGACATCTGTCTTGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043215918 8:77587856-77587878 GTGATGAATTCCATCCTCCTAGG + Intergenic
1044512170 8:93094976-93094998 TTGATGAATGAAATCCCTCTAGG + Intergenic
1047468863 8:125147527-125147549 GTGAAGAAGGAAATCCTTCTAGG + Intronic
1050069883 9:1799498-1799520 TTGCTGAAGGACCTTCTTCTTGG + Intergenic
1053352986 9:37425342-37425364 TTGAGGAAAGACATCCTGCTGGG - Intronic
1058021212 9:100090913-100090935 GTCATGTTTGACATCCTTCTGGG - Intronic
1058027318 9:100155968-100155990 GTGATGGAGGTGATCCTTCATGG - Intronic
1060934600 9:127507866-127507888 GTCATGAAGGACATCCTGCAGGG - Exonic
1185939985 X:4306758-4306780 GTTAAGAGGGACATCCTTCCTGG + Intergenic
1186285745 X:8042317-8042339 GGGATGAAAGACATCCCTATAGG - Intergenic
1186870424 X:13766108-13766130 GTGATGTAGGAAATCAATCTGGG + Intronic
1187248795 X:17578324-17578346 TTGATGAAGGATATACCTCTTGG - Intronic
1187826655 X:23337876-23337898 GCAGTGAAGGAGATCCTTCTTGG + Intronic
1188929678 X:36091735-36091757 GTGAGGAAGGAAACTCTTCTTGG - Intronic
1192614355 X:72603156-72603178 GTGATGCAGGAGATTCTTCATGG + Exonic
1195135196 X:101899126-101899148 GTGAGAAAAGAAATCCTTCTGGG + Intronic
1195734258 X:107996734-107996756 GAGATGATACACATCCTTCTTGG - Intergenic
1196870235 X:120106538-120106560 GTGGTGAGGTACATTCTTCTTGG + Intergenic
1198213325 X:134535007-134535029 GTGAAGAAGGACCTGGTTCTTGG + Intergenic
1199457834 X:148049187-148049209 ATGATGGAGGACATCCTACCTGG + Intergenic
1201723271 Y:17127312-17127334 GTTAAGAGGGACATCCTTCCTGG + Intergenic