ID: 1127300860

View in Genome Browser
Species Human (GRCh38)
Location 15:57652159-57652181
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3201
Summary {0: 1, 1: 0, 2: 22, 3: 286, 4: 2892}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127300860 Original CRISPR ATGAAGGAATGGAGGGAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr