ID: 1127300877

View in Genome Browser
Species Human (GRCh38)
Location 15:57652288-57652310
Sequence TTTAATAAGCATGAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 2, 3: 70, 4: 746}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127300877_1127300878 5 Left 1127300877 15:57652288-57652310 CCATTTTCTTCATGCTTATTAAA 0: 1
1: 0
2: 2
3: 70
4: 746
Right 1127300878 15:57652316-57652338 CTTTCATGCTGCATTAGTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1127300877_1127300879 6 Left 1127300877 15:57652288-57652310 CCATTTTCTTCATGCTTATTAAA 0: 1
1: 0
2: 2
3: 70
4: 746
Right 1127300879 15:57652317-57652339 TTTCATGCTGCATTAGTGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127300877 Original CRISPR TTTAATAAGCATGAAGAAAA TGG (reversed) Intronic
900494056 1:2968356-2968378 TTTAATAAGCGTTAAGTACATGG - Intergenic
901894704 1:12301090-12301112 TATAATAAGCATTCAGCAAATGG - Intronic
902710045 1:18232924-18232946 TTTGTTAAGTATGAAGGAAAAGG + Intronic
903025730 1:20428863-20428885 TGTAATAAGCAGGGAGACAAAGG - Intergenic
903210181 1:21813824-21813846 TTTCAAAAGCAGGAAGAAAAGGG + Intronic
903713119 1:25341046-25341068 TTTAAAAAGCAAAAACAAAAAGG + Intronic
906099979 1:43254018-43254040 TTGAATGAGCAAGAAGAAACTGG + Intronic
906211552 1:44015089-44015111 TTTTATAATCAGGAAAAAAAAGG - Intronic
907134440 1:52125840-52125862 TTTGAAAAAAATGAAGAAAATGG - Intergenic
908437251 1:64119074-64119096 TTTAAGAAGCAAGAAAAACAAGG - Intronic
908476064 1:64489850-64489872 GTTATTAAGGATGAGGAAAAGGG + Intronic
909078791 1:71084769-71084791 TATAATAAGAATAAAGAGAATGG - Intergenic
909686938 1:78359857-78359879 TTCAAGAAGCATGAAGGAACTGG + Intronic
910215792 1:84843066-84843088 TTTAAGCAGCATGAAGACCAAGG - Intronic
910417650 1:87017455-87017477 TATGATAAATATGAAGAAAATGG - Intronic
910651856 1:89576916-89576938 GTTACTTAGCATAAAGAAAAGGG + Intronic
911216151 1:95197816-95197838 ATTAACAAGCATGACTAAAATGG - Intronic
911263418 1:95714731-95714753 TTTAAAAAGTAAAAAGAAAAAGG + Intergenic
911418153 1:97602801-97602823 TAAAATAATAATGAAGAAAAAGG - Intronic
911897083 1:103450061-103450083 CTTAACAAGCATGAAGAATCTGG + Intergenic
913148971 1:116021244-116021266 TTTAATAAACTAGAATAAAAAGG - Intronic
914087354 1:144465154-144465176 TGTAATGAGCAGGAAGAATAGGG - Intergenic
914193132 1:145428126-145428148 TGTAATGAGCAGGAAGAATAGGG - Intergenic
914311257 1:146469049-146469071 TGTAATGAGCAGGAAGAATAGGG + Intergenic
916017451 1:160762699-160762721 ATGGATAAGAATGAAGAAAAAGG + Intergenic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916235352 1:162582311-162582333 TTGAAAAAGGATGAAGATAAGGG + Intronic
916323938 1:163536246-163536268 TTTAGAAAGCAGGGAGAAAATGG - Intergenic
916352260 1:163864192-163864214 TTTAATGAGAATGAAAAAAAAGG + Intergenic
916771447 1:167912677-167912699 TTTAATAGGCAAGAAGGAAGAGG - Intronic
917233330 1:172862211-172862233 TATAAGAAGCAAGAAGAAATTGG - Intergenic
917593517 1:176502810-176502832 TTTAATTTGTGTGAAGAAAAGGG + Intronic
917778977 1:178370845-178370867 TGAAGTAAGCATGGAGAAAAGGG + Intronic
918358843 1:183733991-183734013 TTTACTAAGCCAGAGGAAAATGG - Intronic
918564246 1:185908629-185908651 TTTAAAAATCATAAAGAAATTGG - Intronic
918843648 1:189580248-189580270 TTAATTAAGAAAGAAGAAAAAGG + Intergenic
918878151 1:190077328-190077350 GTTTATAAGCATGAAGTATATGG + Intergenic
919230682 1:194769380-194769402 TTTGGTAAGCATGAAGATCAGGG - Intergenic
921996998 1:221431244-221431266 TTAAAAAAGCAGGAAGAAACAGG - Intergenic
922967293 1:229701180-229701202 TTTAAGAAACAAGAAAAAAAAGG - Intergenic
923182443 1:231532562-231532584 TTTAATAAACTTGAAAAAAAAGG + Intronic
923516737 1:234704008-234704030 TTTAATAAACATGACCCAAATGG - Intergenic
923919102 1:238544374-238544396 TTGCATAAACAAGAAGAAAATGG + Intergenic
924127205 1:240867077-240867099 TTTATTGTTCATGAAGAAAAAGG - Intronic
924185277 1:241482679-241482701 TTTTATAAGCATGGAGAATGAGG - Intergenic
924504548 1:244669362-244669384 TTTTTTAAGCAAGAATAAAAAGG - Intronic
924506219 1:244687233-244687255 TTTAATAAGGAGAATGAAAAGGG - Intronic
924526993 1:244862331-244862353 TTTTAAAAGCAGGAAGATAATGG - Intronic
1063988354 10:11532626-11532648 TTTAATAAGAAATAAGAAAGTGG - Intronic
1064130382 10:12704167-12704189 TTTAAAAAGCTGGAAAAAAAGGG - Intronic
1064554302 10:16533234-16533256 TTTAATAATCAGGAAACAAAGGG - Intergenic
1064591244 10:16892968-16892990 TTTAATAATAATGATGATAATGG + Intronic
1064852994 10:19731291-19731313 TTTTATAAGCAGGGAGAAAATGG + Intronic
1065118387 10:22504400-22504422 TTTAAAAAGCATAAGAAAAAAGG - Intergenic
1065242510 10:23721066-23721088 TTTAATAGGCTTTAAGAAACAGG - Intronic
1065460275 10:25954961-25954983 TTTAAGAAGGATAAAGTAAATGG + Exonic
1065663727 10:28035797-28035819 TTAAAAAAGAGTGAAGAAAAAGG - Intergenic
1066037135 10:31503522-31503544 TGTAATAAGCATGAAGATCCAGG + Intronic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066310735 10:34193463-34193485 GTTAATAACAATGATGAAAAAGG + Intronic
1066706109 10:38179873-38179895 TGTACTAAGAATGAAAAAAAAGG - Intergenic
1067291293 10:44944877-44944899 AGTAAAAAGAATGAAGAAAAAGG - Intergenic
1067396735 10:45927023-45927045 GTTAATAAGAATGAAGAGCATGG + Intergenic
1067865052 10:49896126-49896148 GTTAATAAGAATGAAGAGCATGG + Intronic
1067897147 10:50195398-50195420 GTTGATAAGAATGTAGAAAAAGG + Intronic
1067906838 10:50300388-50300410 TTGAATAAGAGTGAAGAAAATGG - Intergenic
1067951821 10:50746637-50746659 GTTGATAAGAATGTAGAAAAAGG - Intronic
1067983168 10:51110952-51110974 TTGAAAAAGCATAAAGAAAGGGG + Intronic
1068324412 10:55465499-55465521 TTAAATAAGACTGATGAAAAGGG - Intronic
1068767929 10:60784887-60784909 TTGAAATAGCATGCAGAAAATGG - Intronic
1068786074 10:60975689-60975711 TTTACTTAGCAGGAACAAAATGG + Intronic
1069208609 10:65726707-65726729 TTTAATAATCAAGAATGAAAGGG + Intergenic
1069317188 10:67120713-67120735 TATAATATTCATCAAGAAAATGG - Intronic
1069492793 10:68875596-68875618 TTCCATAAGCCTGAAGAAGAAGG - Intronic
1070219840 10:74429432-74429454 TTTTATATGCATGAAAAAGATGG + Intronic
1070648328 10:78217165-78217187 TTTTATGCGCATTAAGAAAATGG + Intergenic
1071810284 10:89172460-89172482 TTTCATCAGCATGAGGATAATGG - Intergenic
1072556236 10:96515976-96515998 TTTAAAAACCATGAAAAAACTGG + Intergenic
1072676625 10:97471355-97471377 TTTTATAAGGGTGAAAAAAATGG - Intronic
1073569870 10:104571272-104571294 TTTAAAAAGCAAGAAAAAATTGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1075450120 10:122545315-122545337 TTGAATATGCATGAAGGAATGGG + Intergenic
1076309192 10:129491957-129491979 TTTAATAATAATAAAGAGAAGGG - Intronic
1076538967 10:131201568-131201590 CTTAATAAGCATGATTTAAATGG + Intronic
1076765090 10:132628854-132628876 TTTAAAAAGCAAAAAGAAATAGG + Intronic
1078945925 11:16068689-16068711 TTTAATAAGAAAGGAAAAAATGG - Intronic
1079180395 11:18188750-18188772 TTTAAAAAGTAAGAATAAAAAGG + Intronic
1079414776 11:20223562-20223584 TGTAATAAGCAGAAAGACAAGGG - Intergenic
1079632360 11:22693742-22693764 TTTACTATGCATTCAGAAAAGGG - Intronic
1080223174 11:29930666-29930688 TTTTATATGCAAGAAGAAACAGG - Intergenic
1081078792 11:38712686-38712708 TATAATAAGCATACAGAAGAGGG + Intergenic
1081205829 11:40274526-40274548 TTTGATAAGCATAATGAAAAGGG + Intronic
1082851481 11:57768914-57768936 GTTCTTAAGTATGAAGAAAAGGG - Intronic
1085677751 11:78540720-78540742 TTTGAAGATCATGAAGAAAAGGG + Intronic
1085810890 11:79680090-79680112 TTTTAAAAGCAAGAAGAAAAAGG - Intergenic
1086438479 11:86804849-86804871 TTCAATGTGCATGAAGAACATGG - Intronic
1087199555 11:95331936-95331958 TATCATAAGCATGTAGCAAAAGG + Intergenic
1087490319 11:98818264-98818286 TTTAAAAGGCATCAAGAAAATGG + Intergenic
1087497820 11:98912464-98912486 TTGAATAATCGTGAAGAAAGCGG + Intergenic
1087561117 11:99792136-99792158 TTTAATAGGAATGGTGAAAATGG + Intronic
1087665506 11:101042406-101042428 TTTAAGAAGCATGTAGAATAAGG - Intronic
1088084773 11:105964263-105964285 TTTAATTAGCATTCAGTAAATGG + Intronic
1088404132 11:109453474-109453496 TTTAAAATGCAAGAAGTAAAAGG - Intergenic
1089473558 11:118740334-118740356 TTTCATGACCATGAAGAAGAGGG - Intergenic
1089799805 11:121016835-121016857 TTTGATAAGCTAGAAAAAAATGG + Intergenic
1089889824 11:121869824-121869846 TTCAATAAACATGAGGAAATGGG - Intergenic
1089999844 11:122947141-122947163 TTTAATAACCATGAAGACTCAGG - Intronic
1090133952 11:124175965-124175987 TTTAATAAGCACTATTAAAATGG - Intergenic
1090152413 11:124399346-124399368 CTTCATAGGCATAAAGAAAAGGG + Intergenic
1091011215 11:132002346-132002368 TTTAATAAGAATTCAGAAATGGG + Intronic
1091536804 12:1418163-1418185 TGTAATCAGCATGAACACAAAGG - Intronic
1091938389 12:4451742-4451764 CGTAATAAACAAGAAGAAAATGG + Intergenic
1092311760 12:7364392-7364414 TTGAATAAATGTGAAGAAAATGG - Intronic
1092806334 12:12226632-12226654 TTTAAAAAGACTGAAAAAAAGGG + Intronic
1093256905 12:16879885-16879907 TTTTATAAGCATGTTTAAAAGGG + Intergenic
1093293496 12:17358986-17359008 TTTGTTAAGCATGAATAAAGGGG - Intergenic
1093454101 12:19347678-19347700 TATAATAAGCAAAGAGAAAAAGG + Intronic
1093668009 12:21837580-21837602 TTTACAAACCTTGAAGAAAAAGG + Intronic
1094026260 12:25962356-25962378 TTTAATTCGCATGACGATAAGGG - Intronic
1094223347 12:28018592-28018614 TTTCATAATAAAGAAGAAAATGG - Intergenic
1094263904 12:28532886-28532908 TTTATCAGCCATGAAGAAAATGG + Intronic
1095287271 12:40428980-40429002 TTTAAAAGACATGAAGAAACAGG + Intronic
1095558720 12:43539724-43539746 TTTAAAAAGCATGCTGAAGAGGG + Intronic
1095894411 12:47266037-47266059 TTTTAGAAACAAGAAGAAAAGGG + Intergenic
1096471976 12:51884498-51884520 TTCTATAAGCAGGAAGAAAGAGG + Intergenic
1097284136 12:57864840-57864862 CTTAATAAGAAAGAAGACAAAGG - Intergenic
1098070104 12:66664759-66664781 TATGATAAGCATGAAATAAATGG + Intronic
1098079538 12:66769409-66769431 TTTCATAAGCATGCAGAAAGAGG - Intronic
1098210397 12:68158036-68158058 TTTAAAAAGTTTGAAGTAAAAGG + Exonic
1098460246 12:70725122-70725144 TAAAATAAGCATGAAGAGACAGG + Intronic
1098528705 12:71516087-71516109 TACAATAAACAAGAAGAAAAAGG + Intronic
1098617091 12:72539979-72540001 TTTTAAAGGCATGATGAAAAAGG + Intronic
1098810250 12:75079225-75079247 ATTGTTAAGCATGAAGAAAGAGG + Intronic
1099015037 12:77334261-77334283 TTGAACAAGCATGATGCAAAAGG + Intergenic
1099105185 12:78487585-78487607 TTTTATCAGCACGATGAAAATGG - Intergenic
1099339759 12:81413885-81413907 ATTAATATACATGAAGAAATGGG + Intronic
1099430929 12:82584551-82584573 TTCCATAAGCAAGAAGAATATGG + Intergenic
1099432276 12:82602007-82602029 TTTAATAATCTTGAGGAAACAGG - Intergenic
1099735066 12:86556659-86556681 TTTAATATGCATTAAGTATAGGG + Intronic
1099798758 12:87430803-87430825 ATTAATATGCAAGAAAAAAATGG - Intergenic
1100130437 12:91486642-91486664 ATTATTGAGCATGAAGAGAAGGG + Intergenic
1100188590 12:92164771-92164793 TTTAATAAGAATGGTGAAAGTGG + Intergenic
1100437539 12:94585361-94585383 TTTGATAAGCATGAGTAAATGGG - Intronic
1100670287 12:96804242-96804264 TTAAATAAGAATGGTGAAAATGG - Intronic
1101312320 12:103593332-103593354 TATAAAAAGCATGAAACAAAAGG - Intronic
1101437737 12:104678667-104678689 CTTAACAAGCATGAAGAAATAGG - Intronic
1101668270 12:106840644-106840666 TTAAATAAGAAATAAGAAAATGG + Intronic
1103770723 12:123321534-123321556 TCTAATGAGGATGATGAAAATGG - Exonic
1105240649 13:18606749-18606771 TTTAAGAAGAAAGAAGAAAGAGG + Intergenic
1106236271 13:27863185-27863207 ATCCATAAGGATGAAGAAAATGG + Intergenic
1106957534 13:34957253-34957275 TGTAATAAAGATGAAGGAAATGG - Intronic
1106967883 13:35094264-35094286 TTTTATCAGGATGAAGAAAAAGG + Intronic
1107080336 13:36367564-36367586 TTTAATAGGCAAGAAGGAAAGGG - Intronic
1107919157 13:45185211-45185233 CTTAATAAGACAGAAGAAAAAGG - Intronic
1108034735 13:46278346-46278368 TATACTAAGCATGAAGAGATTGG - Intergenic
1108432665 13:50369925-50369947 TATGCTAAGCATGAAGAACAGGG - Intronic
1108910764 13:55548847-55548869 ATTCAGAAGCATGAAGATAATGG + Intergenic
1108919990 13:55661425-55661447 AATAATAACCATGAAGAAACTGG + Intergenic
1109017592 13:57038972-57038994 TTTATTAAACATACAGAAAATGG - Intergenic
1109103693 13:58221198-58221220 TTCAAGAAGAAAGAAGAAAAAGG - Intergenic
1109218213 13:59614305-59614327 TTTAATAAATATGAAAAAAGTGG - Intergenic
1109296973 13:60545422-60545444 TTTAATAATCATGACCAAGAGGG - Intronic
1109401526 13:61835842-61835864 TGTAATAAGGGTGAAGAAATTGG + Intergenic
1109414779 13:62024526-62024548 TTGAATATGCATGGTGAAAAGGG + Intergenic
1109643112 13:65217978-65218000 TTTAAGAAAGATGAAGGAAAGGG - Intergenic
1109647609 13:65279783-65279805 ATAAATAAGCATCAAGATAATGG - Intergenic
1109761515 13:66835817-66835839 TTTAATAAGTATGTATTAAACGG - Intronic
1109836758 13:67868889-67868911 TTTAAAAAGAATAAAGAGAAAGG - Intergenic
1109861807 13:68209439-68209461 TTTGAGAAGAATAAAGAAAAGGG - Intergenic
1109946538 13:69441404-69441426 TTTACTTTGCATGAAGACAATGG + Intergenic
1109982802 13:69932133-69932155 TATACTAAGCATTAAGAATATGG + Intronic
1110101444 13:71610748-71610770 CTTAGTAAACAAGAAGAAAAAGG + Intronic
1110689744 13:78418560-78418582 TTTAAAAGGTATGAAGACAAAGG + Intergenic
1110910003 13:80947694-80947716 TTTTAAACGAATGAAGAAAAAGG + Intergenic
1110910286 13:80952460-80952482 ATTAATAGGGATGAAGTAAAAGG + Intergenic
1111427801 13:88111338-88111360 ATTAATATGCATGAATAAAATGG + Intergenic
1111819630 13:93196640-93196662 TTTAATGAGAATGTATAAAATGG - Intergenic
1112277962 13:98038345-98038367 TTTAAAAAGTAAGAAGAAAGGGG - Intergenic
1112432115 13:99359256-99359278 TTTGATAACCTGGAAGAAAAAGG + Intronic
1112621681 13:101059744-101059766 TTTAATAAAAATAAATAAAATGG - Intronic
1113079008 13:106496954-106496976 TTTGATAATCAGGTAGAAAATGG - Intronic
1113321833 13:109240839-109240861 TTTAAAAAGAAGGAAGAAAAGGG + Intergenic
1113748283 13:112761299-112761321 CTTAATAAGGAAAAAGAAAATGG + Intronic
1113762818 13:112861756-112861778 TTTAATAAATCTAAAGAAAATGG + Intronic
1113762825 13:112861869-112861891 TTTAATAAATCTAAAGAAAATGG + Intronic
1114400358 14:22404670-22404692 TTGGATAAGCAGGAAGGAAAAGG + Intergenic
1114468785 14:22944177-22944199 CTTAAAAAGCCTAAAGAAAATGG - Intergenic
1114732887 14:25012925-25012947 TTCAATAAGAATAAAGGAAATGG + Intronic
1114786690 14:25608262-25608284 TTTATTAAGCATAAAGATCAGGG + Intergenic
1114859842 14:26503211-26503233 TTTAAAAATCCTTAAGAAAAAGG + Intronic
1116201890 14:41808147-41808169 GTTAAGAAGCATAAAGAAAGTGG + Intronic
1116248002 14:42442449-42442471 TTTTAAAAGAAAGAAGAAAAAGG - Intergenic
1116627092 14:47279295-47279317 ATTAATAAGCCTGATAAAAATGG - Intronic
1116669617 14:47823999-47824021 AATAATAAGAATGAAGAAGAGGG + Intergenic
1117138670 14:52764383-52764405 TTTAGAAAGCTTGAAGGAAAAGG - Intronic
1117422020 14:55555968-55555990 TTTAGTGAGGATGAAGAAATTGG + Intergenic
1117431667 14:55671377-55671399 TTTAATAAAAATGACCAAAAGGG + Intronic
1117487069 14:56208686-56208708 TTTATTATGCATGATGAAATGGG + Intronic
1118185989 14:63539075-63539097 TTTAAAAATCAAGAAAAAAATGG - Intronic
1118408127 14:65447446-65447468 TTTTATAATAATGAAGGAAAAGG + Intronic
1118856398 14:69626650-69626672 GGTATTAAGCATGAAAAAAATGG - Intronic
1119245695 14:73104770-73104792 TTAAACTAGCCTGAAGAAAAAGG - Intronic
1120115640 14:80614163-80614185 TTAAAAAAGAATGAAAAAAAGGG + Intronic
1120587401 14:86330317-86330339 TTTAAAAAGCTTGTAGAATAAGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1120842301 14:89096776-89096798 CTTAATAGGCTTGAAGAAAAGGG - Intergenic
1122653684 14:103242321-103242343 TTTCAGAAACATGAAGATAATGG + Intergenic
1123016617 14:105378772-105378794 TATAATATGTACGAAGAAAAAGG - Intronic
1123193807 14:106597367-106597389 ATTAATAAGAAAGAAGATAAGGG - Intergenic
1123764335 15:23461847-23461869 TTTCAAAACCATGAAGGAAAAGG - Intergenic
1125138378 15:36371361-36371383 TTAAAAAAGAAAGAAGAAAAGGG + Intergenic
1125182604 15:36894914-36894936 TTTAAAAAGAAAAAAGAAAAAGG + Intronic
1125234307 15:37494521-37494543 TTTAATAAGCATTTAAATAAGGG + Intergenic
1125557114 15:40595000-40595022 TTAAATAAACGTGAAGAATAAGG - Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126402569 15:48288117-48288139 TTTAAAAAGAAACAAGAAAAAGG + Exonic
1126654332 15:50959387-50959409 TTTTATAGGCAAGGAGAAAATGG + Intronic
1126775147 15:52094123-52094145 TTAAATATCCATGGAGAAAAAGG + Intergenic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1127743528 15:61938659-61938681 CTTAAAAAGCATAAAGGAAAAGG + Intronic
1128579841 15:68801718-68801740 TTTAATAGGAAGGAAAAAAATGG - Intronic
1128586165 15:68852410-68852432 TAAAATAAACATGAAGAGAAAGG + Intronic
1129066624 15:72910127-72910149 TCAAATAAGAATGAAGGAAAAGG - Intergenic
1129638441 15:77348577-77348599 TTGAAAAAGCAGGCAGAAAAAGG + Intronic
1130614651 15:85393166-85393188 TTTAACAAGCTGGAAGAAAATGG + Intronic
1131647942 15:94366099-94366121 TTTCATAAGCATGATGTAAGTGG - Intronic
1131894754 15:97014432-97014454 TTTAATGAACATGAAATAAACGG - Intergenic
1131954121 15:97713274-97713296 TATAATAGGTATCAAGAAAATGG - Intergenic
1133465604 16:6024334-6024356 TTTCATAAGGATAATGAAAAGGG + Intronic
1133853520 16:9527954-9527976 TTTATTATGCATGAAGAACTAGG - Intergenic
1134832273 16:17333156-17333178 TTGAATGAGGATGAAGGAAATGG - Intronic
1134868547 16:17630817-17630839 TTTAATAATCAGGCAAAAAATGG + Intergenic
1134890046 16:17832839-17832861 ATTAATCAGCAGGTAGAAAATGG - Intergenic
1135129894 16:19844719-19844741 TTTACCAAACATGAAGAAAGAGG - Intronic
1135417031 16:22276422-22276444 TTGAATAAGGAAGAAGAATAAGG - Intronic
1135929951 16:26727957-26727979 ATTAATCATCATGAAGAATAGGG + Intergenic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1137330139 16:47486026-47486048 TTTAGTAGGAAGGAAGAAAAAGG - Intronic
1138896507 16:61211793-61211815 TTTACTAAGCATGTAAAATACGG + Intergenic
1139082245 16:63536941-63536963 TTTAATAACCATGAAGCCAATGG - Intergenic
1139577762 16:67852981-67853003 TTTAAAAAGAAAGAAAAAAAGGG - Intronic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1140597044 16:76428813-76428835 TATAATAAGCACTAAGGAAACGG - Intronic
1141326488 16:83064488-83064510 TTTAAAAAGTAAAAAGAAAAAGG + Intronic
1142371385 16:89684852-89684874 TTTGATCAGCATGTAGAAAATGG - Intronic
1144136850 17:12303302-12303324 TTCAAAAAGCATTAAAAAAATGG - Intergenic
1146820953 17:35983416-35983438 TATAGAAAGCATTAAGAAAACGG + Intronic
1146980202 17:37153267-37153289 AGAAATAAGCATGAAGAAATTGG + Intronic
1147329868 17:39691714-39691736 TTTCAATAGCAAGAAGAAAAAGG + Intronic
1148180165 17:45599911-45599933 TTTAATCTGTATGAAGAAAAAGG + Intergenic
1148251781 17:46087829-46087851 TTTAATAACCATGAAAAGAAAGG + Intronic
1148268732 17:46245984-46246006 TTTAATCTGTATGAAGAAAAAGG - Intergenic
1148277774 17:46320742-46320764 TTTAATCTGTATGAAGAAAAAGG - Intronic
1148299981 17:46538597-46538619 TTTAATCTGTATGAAGAAAAAGG - Intronic
1148368366 17:47073552-47073574 TTTAATAACCATGAAAAGAAAGG + Intergenic
1148978789 17:51552993-51553015 TTTAAAAAGCATAAAGAAACAGG - Intergenic
1149245582 17:54702145-54702167 TTTAAAAAGCATAAATAAATTGG + Intergenic
1149724434 17:58879225-58879247 TTTAATAACTTTGAAGCAAAAGG + Intronic
1149766962 17:59287184-59287206 TTTCATAAATATGATGAAAATGG - Intergenic
1150034669 17:61781594-61781616 TTCAATAAGAATCTAGAAAATGG + Intronic
1150402523 17:64870702-64870724 TTTAATCTGTATGAAGAAAAAGG + Intronic
1150783437 17:68142762-68142784 CTTAATCTGTATGAAGAAAAAGG + Intergenic
1152975378 18:212018-212040 TTTAATAATAATAAAAAAAAAGG + Exonic
1153272781 18:3339888-3339910 TTTGATAAAAATGTAGAAAATGG - Intergenic
1153547348 18:6221342-6221364 TTTAATAAGCAGCAATAAAAGGG + Intronic
1153761638 18:8337631-8337653 TTTAAACATCATGAAGAAACAGG + Intronic
1153913505 18:9724511-9724533 TTTAATAAGGAAGAAGCCAAGGG - Intronic
1153974177 18:10252424-10252446 TTTATTAATCATTAAGAGAAGGG + Intergenic
1153990274 18:10391840-10391862 TTAACTAAGCCTAAAGAAAATGG + Intergenic
1154127579 18:11705690-11705712 GTTATTAATCATGAGGAAAATGG - Intronic
1154448228 18:14452319-14452341 TTTAAGAAGAAAGAAGAAAGAGG - Intergenic
1155543886 18:26894377-26894399 TTTGTTAAGAATTAAGAAAAGGG + Intergenic
1155574186 18:27227178-27227200 CTTAATAATCATGAAAATAAGGG - Intergenic
1155608868 18:27640171-27640193 TATGAAAAGAATGAAGAAAAAGG + Intergenic
1155609228 18:27644638-27644660 TTCAAAAAACATGAAGAATATGG + Intergenic
1156602300 18:38623864-38623886 TTTAATAAGCATGAAAATGTAGG + Intergenic
1156705357 18:39875057-39875079 TTTAATATGAAGAAAGAAAAGGG - Intergenic
1156749677 18:40436361-40436383 TTTAATCAGCAGTATGAAAACGG + Intergenic
1156776163 18:40792008-40792030 TTTAAAAAAGATAAAGAAAAAGG - Intergenic
1156914090 18:42445108-42445130 TTTATTAAGAATGAACAAAAAGG - Intergenic
1157010469 18:43642505-43642527 TTTAAGAAGAAAGAATAAAAAGG - Intergenic
1157460925 18:47892842-47892864 TTTCATAAGCATAAATTAAAAGG - Intronic
1157534148 18:48446307-48446329 TTTAAAAAGAAAAAAGAAAAAGG - Intergenic
1157739885 18:50083043-50083065 ATTACTGAGCCTGAAGAAAAGGG - Intronic
1158233073 18:55280295-55280317 TATAATAAGCATGAAAAAGGAGG - Intronic
1158499991 18:57992251-57992273 TTCAAAAAATATGAAGAAAATGG - Intergenic
1159053675 18:63444532-63444554 TTGAATAAACAGGAAAAAAAAGG - Intergenic
1159093279 18:63872954-63872976 TTTAAGGAGCATGTATAAAATGG + Intronic
1159187693 18:64998650-64998672 TTCATTAAACATGAAGTAAACGG + Intergenic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1160422885 18:78760076-78760098 ATTTATAAGCATAAAGAAACAGG + Intergenic
1160623803 18:80189257-80189279 TTTAAAAAGAAAGAAGAAAACGG - Intronic
1164100595 19:22051519-22051541 TTTAAAAAGAAAGAAGAAATAGG - Intergenic
1164111978 19:22172723-22172745 TTTAATAAGACTGAAGAAAGTGG - Intergenic
1164226539 19:23250845-23250867 TTTAAAAAGAAACAAGAAAAAGG + Intergenic
1164481871 19:28617693-28617715 TTCAGTAAGCATGAACATAAGGG + Intergenic
1165667164 19:37642264-37642286 TTTAAAAAGCATAAATTAAAAGG - Intronic
1165849674 19:38842420-38842442 TTTATTAAACATTAAAAAAAAGG - Intronic
1166042013 19:40209335-40209357 TGTGATAAGAATGAGGAAAAGGG - Intronic
1166148422 19:40852751-40852773 TTTAAGAAACACGAAGGAAAAGG - Intronic
1166152566 19:40884536-40884558 TTTAAGAAACAAGAAGGAAAAGG - Intronic
1166586954 19:43957684-43957706 GTTAATTAGCAAGAGGAAAAAGG - Intronic
1167932434 19:52877104-52877126 TTTAATAGAAATGAAGAAAAAGG + Exonic
925156748 2:1654246-1654268 TTTAAAAATCATGAACAACATGG - Intronic
925319729 2:2953064-2953086 ATTAAAAATCATGAAGAAAGGGG - Intergenic
925346884 2:3177853-3177875 CTTAATAAGCGTGTGGAAAATGG - Intergenic
925593279 2:5531092-5531114 TTCAGTAAGACTGAAGAAAAAGG + Intergenic
925601262 2:5610897-5610919 TTTAATAAGCAGCAAGAGAGAGG - Intergenic
925650267 2:6081906-6081928 TTTTATAAGCATTAGGAAACTGG - Intergenic
926201192 2:10799373-10799395 TTTAATCAGCATGAAGCTGAGGG + Intronic
926554234 2:14338666-14338688 TTTAATAAGCTAGAATAAATTGG + Intergenic
926858570 2:17283673-17283695 TTTAGTATGCCTGGAGAAAAGGG + Intergenic
927220096 2:20698891-20698913 TTTTATATGCTTGAGGAAAATGG - Intronic
927697785 2:25249860-25249882 TTTGAAAGGCATGTAGAAAATGG - Intronic
928047441 2:27950681-27950703 TTTGAAAAAAATGAAGAAAAGGG - Intronic
928466238 2:31525463-31525485 TTTAATAACCACAAACAAAAAGG - Exonic
928541401 2:32287423-32287445 TTTAATAAGCAACAAGAGCAAGG - Intronic
928791379 2:34959376-34959398 TGTAAAAAGCAAGAAGAACAAGG + Intergenic
929410859 2:41696310-41696332 TTACATAAGCAAGAATAAAAGGG - Intergenic
929621467 2:43359083-43359105 TTTAATAATTATGCATAAAATGG - Intronic
929662255 2:43798719-43798741 TTTAATAAGCCTAAAGGAACAGG + Intronic
930251621 2:49041129-49041151 TCAAAGAAGCCTGAAGAAAAAGG - Intronic
930326235 2:49922390-49922412 TTTAGTAACCATGAGGCAAAGGG - Intronic
930368783 2:50477679-50477701 TTTAAAAAGCATACAGAAAAAGG + Intronic
930636425 2:53810853-53810875 TTTAATAACAATACAGAAAAAGG + Intronic
930788254 2:55294829-55294851 TTTTAAAGGCATGCAGAAAATGG + Intronic
930934621 2:56932830-56932852 TTTAATTATCTTGGAGAAAAAGG - Intergenic
930945256 2:57066288-57066310 TTTTTCAAGCATGAAAAAAAAGG + Intergenic
931091894 2:58895246-58895268 TTTAATAGGCAAGAAGTGAAGGG + Intergenic
931250289 2:60524784-60524806 TTTCAGAAGCATGCTGAAAAAGG - Intronic
931404868 2:61966420-61966442 TTAAATTAGCATGCAGAATATGG + Intronic
931848420 2:66228706-66228728 GTTAATAAGCAGAAATAAAAGGG - Intergenic
931913748 2:66930462-66930484 TTTCCTAAACAGGAAGAAAATGG - Intergenic
932632764 2:73360356-73360378 TATAATAAGAAAAAAGAAAATGG - Intergenic
933009846 2:77046696-77046718 TTTAAAAAGCATAGAGAAAAAGG + Intronic
934128099 2:88918420-88918442 ATTTATAAGCCAGAAGAAAAAGG + Intergenic
934128561 2:88922820-88922842 GTTAATGGACATGAAGAAAAAGG + Intergenic
935231716 2:101103978-101104000 ATTAATAAGCAAGTAGAACAAGG + Intronic
935255244 2:101304427-101304449 CTTAGGAAGCATAAAGAAAAGGG - Intronic
935511191 2:103976573-103976595 TTCAGTAACAATGAAGAAAAAGG + Intergenic
935544921 2:104390776-104390798 TTTTCTAAGCAGGAAGCAAAAGG + Intergenic
935811394 2:106800879-106800901 TTTAATTAGCTGGAAGAAAGTGG + Intergenic
935921090 2:108016072-108016094 TATGATAAGGATGAAGAAAAAGG + Intergenic
936685335 2:114820992-114821014 TTTAATATGCAAGAAGGAAGTGG + Intronic
936861632 2:117027072-117027094 TGTAATAAGCAGGAGGAACAGGG - Intergenic
937169713 2:119853937-119853959 TTTAATAAGAAAGAAGGAAAAGG + Intronic
937942986 2:127302899-127302921 TTTAAAAAGGAGGTAGAAAAGGG + Exonic
939047957 2:137271697-137271719 ATAATTAAGCAAGAAGAAAAGGG - Intronic
939073009 2:137566429-137566451 TTTTATAAGCATAAATAACAAGG + Intronic
939116358 2:138065963-138065985 TCAATTAAGAATGAAGAAAAGGG - Intergenic
939156329 2:138528703-138528725 TTTAATAACCCAGAACAAAAGGG - Intronic
939229402 2:139407097-139407119 GTTAATAAATATAAAGAAAAAGG + Intergenic
939313140 2:140510709-140510731 ATTATTATGCATGAAAAAAATGG - Intronic
939592917 2:144087906-144087928 TTGAATAAGAATGGAGAAATTGG - Intronic
939715219 2:145575456-145575478 TATAATGAGCATGAATAAAGGGG - Intergenic
939904225 2:147890923-147890945 TTTCATAAGTAGAAAGAAAATGG - Intronic
940264391 2:151820998-151821020 TTAGATAAACATGATGAAAAAGG + Intronic
940805013 2:158177365-158177387 AAGAATTAGCATGAAGAAAATGG + Intronic
940951917 2:159685055-159685077 TTTAATATGCATACATAAAAAGG - Intergenic
941350483 2:164427204-164427226 TTAAATATGCTTGAAGAAACTGG + Intergenic
941988768 2:171534318-171534340 TTCAATGAGAAGGAAGAAAAAGG - Intronic
942177143 2:173345030-173345052 TTTAATAAGAATGGTTAAAATGG - Intergenic
942367879 2:175247934-175247956 TTTAAAAAGTTTGTAGAAAATGG - Intergenic
942788289 2:179728237-179728259 TTTAAAAAGAGAGAAGAAAATGG - Intronic
943235191 2:185308788-185308810 TTTATTAGGTAAGAAGAAAATGG - Intergenic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
943690870 2:190868582-190868604 TAAAATAGGCAAGAAGAAAAGGG + Intergenic
943962585 2:194285638-194285660 TTTGATAAGGATGTGGAAAAAGG - Intergenic
944040488 2:195348635-195348657 ATTAATTTGCATGAAGTAAAAGG - Intergenic
944040961 2:195354495-195354517 TTTAAAAAGAAAGAAGAAAATGG + Intergenic
944119203 2:196222864-196222886 AATAAGAACCATGAAGAAAAAGG - Intronic
945160281 2:206883407-206883429 TTTAATAATCAGGAAATAAAAGG - Intergenic
945379876 2:209128194-209128216 TCTAATAAGAATTAAGAATAGGG - Intergenic
945470574 2:210224424-210224446 TTTAATAAGGGTGAAGGAACTGG - Intronic
945756212 2:213850206-213850228 TTGAATAACTTTGAAGAAAATGG + Intronic
946039391 2:216770845-216770867 TTTACTAAGCAGAAAGAAAGTGG + Intergenic
946220860 2:218225483-218225505 TTTAATATGCTTAAAGAGAAAGG - Intronic
946578165 2:221099077-221099099 TTTTATAAGCATGAAGACAATGG + Intergenic
946779602 2:223179316-223179338 TTTAAAAAAAATGGAGAAAAGGG + Intronic
947151937 2:227124497-227124519 ATGAATGAGCATGAAGAAAAGGG - Intronic
947267515 2:228299918-228299940 TTTAATAGGCAAGAAAAAAGGGG + Intergenic
947573521 2:231253939-231253961 TTTAAAAAGGAAGAACAAAAAGG + Intronic
947705171 2:232268999-232269021 TTTAATTAGCCTGAAGCAAAAGG + Intronic
947772983 2:232685652-232685674 TTTAAAAAGAAGGAAGAGAATGG + Intergenic
947853898 2:233310269-233310291 TTTAAAAAGTAAGAAGAAACAGG + Intronic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
1168735044 20:127270-127292 TTTAGTAAGAATGTAGCAAATGG - Intergenic
1169621862 20:7516036-7516058 TTTAATAAGAAAGAAAGAAAAGG - Intergenic
1170053465 20:12172730-12172752 TGTAATAAGCAGGAAGAACTAGG - Intergenic
1170104593 20:12739867-12739889 ATTAATAAAAATGAAAAAAAAGG + Intergenic
1170181801 20:13539251-13539273 TTTAATAGGTATGAATTAAATGG + Intronic
1170207591 20:13815379-13815401 GTTAATTATCATCAAGAAAAAGG - Intronic
1170826016 20:19796444-19796466 TTAAATAAAAGTGAAGAAAATGG + Intergenic
1171124775 20:22592005-22592027 TTAAATAAGCATTAAGGGAATGG - Intergenic
1171813966 20:29766549-29766571 TTTAAAAATCAAGAAAAAAATGG - Intergenic
1173878767 20:46394706-46394728 TTAAATCAGCAAGAAGAAATGGG + Intronic
1174613641 20:51819368-51819390 TTTAAGAAAAATGAAGAAATAGG - Intergenic
1175061036 20:56243605-56243627 TTTTATAAGTGTGAAGACAAGGG - Intergenic
1175102238 20:56587541-56587563 TTTCATGAGCATGAAGCAAGGGG - Intergenic
1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG + Intergenic
1177220969 21:18192358-18192380 TTTTATAAGCATCATGAACAAGG + Intronic
1177392386 21:20493155-20493177 TTTAATAACAATGATGAGAATGG + Intergenic
1177713321 21:24807837-24807859 TTTAATAAGGAAGTAGCAAAAGG - Intergenic
1178251525 21:31007938-31007960 TTTGACAAGCATTAAAAAAAAGG - Intergenic
1178467456 21:32860769-32860791 TTTTATAAGCATTAGGAAATTGG - Intergenic
1178545836 21:33492148-33492170 TTTAACAAGGAAAAAGAAAAAGG + Intergenic
1179079328 21:38156052-38156074 TTTAATAACAATGCAGAACAAGG + Intronic
1179311691 21:40201749-40201771 CTTAATAATTATGTAGAAAAAGG + Intronic
1179650963 21:42808380-42808402 TTTAATAGGCAAGAAAGAAAAGG - Intergenic
1180317419 22:11287171-11287193 TTTAAAAATCAAGAAAAAAATGG - Intergenic
1180690654 22:17712488-17712510 TTTTACAAGGAAGAAGAAAATGG - Intronic
1181518360 22:23431091-23431113 ATTACTAAGCATGCAAAAAAAGG - Intergenic
1182392381 22:30009647-30009669 TTTAATAAGCAATAAGAATCAGG - Intronic
1183510938 22:38234495-38234517 TATAATATCCATGAAGAAACTGG + Intronic
949599537 3:5582984-5583006 TTAAATAAGAATGGACAAAATGG - Intergenic
951327019 3:21314538-21314560 TTTAAAAAAGATGAACAAAATGG - Intergenic
951618944 3:24579669-24579691 TGCAAAAAGCATGAAGAAGAAGG - Intergenic
952393523 3:32901590-32901612 TTTAGTAACCATAAAGAAATTGG - Intergenic
952521854 3:34168736-34168758 ATTAAAAGGCATGAGGAAAAGGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953357550 3:42267316-42267338 TTGAATAAACATGAATTAAATGG - Intergenic
953635573 3:44661007-44661029 TTTTAGAAGGATGAAGAAACTGG + Intergenic
953824889 3:46242707-46242729 TAGAAAAAGCAAGAAGAAAATGG - Intronic
954090209 3:48278268-48278290 TTTAAAAAGTTTGAAGAGAAAGG + Intronic
954561848 3:51563337-51563359 TTTAAAAAGGAGGAAGAAGATGG - Intronic
955726995 3:61943777-61943799 TTGAAAAAGCATGAATGAAATGG + Intronic
956526682 3:70171562-70171584 TTGAAAATGCATGAAAAAAATGG + Intergenic
956971617 3:74532853-74532875 TTCAAAATGCAAGAAGAAAAAGG + Intergenic
957126653 3:76170125-76170147 TTTAAAATGACTGAAGAAAATGG - Intronic
957843879 3:85705166-85705188 TTAAATAAGAATGAAAAGAAGGG - Intronic
957843979 3:85706827-85706849 TTAAATAAGAATAAAGAAAAAGG + Intronic
958431018 3:94041340-94041362 CTTAATAACCATTTAGAAAAAGG + Intronic
958652058 3:96949028-96949050 TTTATTGAGCATTATGAAAAGGG - Intronic
959569279 3:107866021-107866043 TTAAATAACCATGATTAAAATGG - Intergenic
959625692 3:108446818-108446840 TATAATAAACATGAAGAATCAGG + Intronic
959938501 3:112055644-112055666 TTCAATAAGGCTGAACAAAAAGG + Intronic
960150080 3:114240330-114240352 TTTAATCAGCAAAATGAAAATGG - Intergenic
960496260 3:118378765-118378787 TTTAATAAGCAAGCTGATAAAGG + Intergenic
960883674 3:122372519-122372541 CTTAAAAAGCATCAAGAAAATGG + Intronic
960983183 3:123250831-123250853 TTTAATTTGCATAAAGAAACTGG + Intronic
961933524 3:130558767-130558789 TTTTATAAGCAAAAATAAAAAGG + Intergenic
961969427 3:130944678-130944700 TTTAAAAAGTATAAACAAAATGG - Intronic
962955334 3:140260970-140260992 TTTACTTAACATGATGAAAAGGG - Intronic
963098780 3:141577137-141577159 TTTAATAAAAATTAAAAAAATGG - Intronic
963371808 3:144410926-144410948 TTTAATAAGAACGATGAGAAGGG + Intergenic
963949708 3:151185469-151185491 TTCAACAAGCAGAAAGAAAATGG - Intronic
964193272 3:154031349-154031371 TTTAGAAAGCATGCAGAAAGAGG + Intergenic
964295354 3:155227123-155227145 TTTAATTAGAATAAAGACAATGG - Intergenic
964549942 3:157874752-157874774 TTTTAGCAGCATGGAGAAAAAGG + Intergenic
964614601 3:158649193-158649215 TTTAAAAAGCATTAAAAAGAAGG + Intronic
964818630 3:160744770-160744792 TGTTCTAAGCATGATGAAAAAGG + Intergenic
964993015 3:162838048-162838070 TTTAATAATGAGGAAGTAAAAGG + Intergenic
965060313 3:163776302-163776324 TTTACTAAAAATGAAGTAAAGGG - Intergenic
965173282 3:165296212-165296234 TTTTATAATCAAGAATAAAAAGG - Intergenic
965885802 3:173445710-173445732 TTCAACAAGAATGAAGAATAAGG - Intronic
966031734 3:175357185-175357207 TTCAAAGAGCAAGAAGAAAATGG - Intronic
966132469 3:176657449-176657471 TATAATAAACATACAGAAAATGG + Intergenic
966267818 3:178067700-178067722 TTTCATATGCAGGCAGAAAATGG + Intergenic
966268076 3:178070825-178070847 TTTATTAAGGAAGAAAAAAATGG - Intergenic
966269480 3:178087455-178087477 TGTTATCAGCATGTAGAAAATGG - Intergenic
967513505 3:190340277-190340299 TTTCATCAGCAGGATGAAAATGG - Intronic
969148672 4:5147403-5147425 TTTAAAAAGCATAAATAAAGGGG - Intronic
969878124 4:10150964-10150986 GTTACTCTGCATGAAGAAAAAGG + Intergenic
970255731 4:14168035-14168057 CTGACTAACCATGAAGAAAATGG - Intergenic
971026565 4:22594609-22594631 TTTGTTAAGAGTGAAGAAAAGGG + Intergenic
971160392 4:24127734-24127756 TTTCATAAGCATCAATAAATAGG + Intergenic
971727889 4:30336817-30336839 TTTTAGGAACATGAAGAAAATGG - Intergenic
972042315 4:34618647-34618669 TTGCATAATCATGAAGAATAAGG - Intergenic
972148126 4:36054634-36054656 TTTAATTACCATGCACAAAATGG + Intronic
972446449 4:39148985-39149007 TTTTATCAGAAGGAAGAAAATGG - Intergenic
972701115 4:41494262-41494284 TTCAATAATCTTGAAAAAAACGG - Intronic
972796212 4:42422479-42422501 TTTAATGAGCATTAAATAAATGG - Intronic
972885652 4:43483280-43483302 TTTGCTAAGCCTAAAGAAAATGG - Intergenic
972939442 4:44179364-44179386 TTCAAGAACTATGAAGAAAAGGG + Intronic
973194854 4:47427847-47427869 TTTAGAAAGCAAGAGGAAAAGGG + Intergenic
973751667 4:54025881-54025903 TTTAAAAAACAAGAAGAAAGGGG + Intronic
974092861 4:57330491-57330513 ATTAATAATGATGAAGAAAAAGG - Intergenic
974199010 4:58614625-58614647 TATAATAAGTCTGAAGCAAAGGG + Intergenic
974444695 4:61964788-61964810 TTTCTTAAGCATGAATAAATTGG - Intronic
974456851 4:62139346-62139368 TTGTAGAATCATGAAGAAAATGG + Intergenic
974557535 4:63471149-63471171 ATAAACAAGTATGAAGAAAAAGG - Intergenic
974642910 4:64654863-64654885 TTTCAGAAGCAGGAAGACAATGG - Intergenic
974982201 4:68972467-68972489 TTTGCTAAACATGAAAAAAAGGG - Intergenic
975237001 4:72011038-72011060 TTTAAACTGCCTGAAGAAAAGGG - Intergenic
975317865 4:72976532-72976554 TTTGATAATTATGAAGAAAGTGG + Intergenic
976318047 4:83680712-83680734 CTTACAAAGCATGAAGAAAAAGG + Intergenic
976431084 4:84965220-84965242 TTTAAAAAGCCCGAAGAATAGGG + Intronic
976527492 4:86111264-86111286 TTTAATAGGCATGAAGAGAGAGG + Intronic
976818373 4:89176201-89176223 TTCAATAAGCATGGATAAAGTGG + Intergenic
976899082 4:90151545-90151567 ATTTAAAAGCATTAAGAAAAAGG - Intronic
977534999 4:98247151-98247173 TTTAATAATGAAGGAGAAAATGG + Intergenic
978296821 4:107215089-107215111 TTTAGAAAGCAGGAATAAAATGG - Intronic
978757216 4:112315381-112315403 TTTATTATGCATGAAATAAAAGG - Intronic
978986033 4:115014123-115014145 ATTGATAAGGATGAAGTAAAAGG - Intronic
979036037 4:115719563-115719585 TTATATAAGCATGAAGCAAGTGG - Intergenic
979321893 4:119334573-119334595 TTTAAAAAACTTGCAGAAAAAGG - Intergenic
979780626 4:124647114-124647136 TCCAACAAGCATGGAGAAAAAGG - Intergenic
979857093 4:125647437-125647459 TTTATGAAGAATGAACAAAATGG + Intergenic
980173284 4:129314723-129314745 TTTAAAAAGCAAAAACAAAAAGG - Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
980344970 4:131602081-131602103 TGTAATCATCATGAAGAATAAGG + Intergenic
980623163 4:135336532-135336554 TTTAACAAGTATGTGGAAAATGG - Intergenic
980648867 4:135684069-135684091 TTTAAAAAGCATAGAGAAAGAGG + Intergenic
980660944 4:135856696-135856718 TTTAATAAAAATGTAGAAAGAGG + Intergenic
981337012 4:143580092-143580114 TTAAAAAAGAATGAAAAAAAGGG + Intronic
981987060 4:150870040-150870062 CTTAAAAAGCAAGATGAAAAAGG + Intronic
982054534 4:151534747-151534769 ATTAGTGAGCATGGAGAAAATGG + Intronic
982148106 4:152420633-152420655 TTTATCAAGCATGAAAAAATAGG + Intronic
982356886 4:154480541-154480563 TTTCAAAAGCATGAAGGAGATGG + Intronic
982433007 4:155344759-155344781 TTTCATAATAATGAAGAAAGTGG - Exonic
982604772 4:157500456-157500478 TTGAATAAGGATGTAGCAAATGG + Intergenic
982628458 4:157799829-157799851 TTCAAAATGCATGAAGCAAAAGG - Intergenic
983414196 4:167435278-167435300 ATTAATAAGGATGATGATAAAGG + Intergenic
983471144 4:168156938-168156960 TTTAATAAGCCTGAGGATAGAGG - Intronic
983537638 4:168875355-168875377 CTTAATGAGGAAGAAGAAAATGG + Intronic
983645283 4:169983436-169983458 TTTAAAAAATATAAAGAAAAAGG + Intergenic
983725763 4:170923912-170923934 TTTAACAACCATGAAAAAAGTGG + Intergenic
983775180 4:171597788-171597810 TTTAATAGGCAAGAAAGAAAGGG + Intergenic
983789592 4:171779940-171779962 TTTAATAAGCCGGAAAAATATGG - Intergenic
983913888 4:173269855-173269877 TTTTATAATCATGCAGGAAAAGG + Intronic
984036896 4:174680490-174680512 TTGAATAACCCTGAAGAAAGTGG + Intronic
984540807 4:181034877-181034899 ATTACTAGTCATGAAGAAAAAGG + Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
985377704 4:189359559-189359581 GTAACTAAGCATGGAGAAAAGGG + Intergenic
986153279 5:5147640-5147662 CTTGTTAAGCATGAAGACAATGG + Intronic
986235591 5:5907115-5907137 TTCAATAGACATGGAGAAAAAGG - Intergenic
986508866 5:8481512-8481534 TTAAATAAACCTGAAGAAACAGG + Intergenic
986774674 5:11003004-11003026 TTTAAAAAACAGGTAGAAAAAGG - Intronic
987462786 5:18233432-18233454 TTAAATAAATAAGAAGAAAAAGG - Intergenic
987625502 5:20394841-20394863 ATTACTAATCATGAGGAAAATGG + Intronic
987628102 5:20429548-20429570 TTCAAGAACAATGAAGAAAAAGG - Intronic
987770879 5:22303015-22303037 TTTAAAAAGGAAGAAGAAAGAGG + Intronic
987824783 5:23016507-23016529 TTTTATATGCTTAAAGAAAAAGG - Intergenic
987841938 5:23233396-23233418 TTAATTAAGCATGGAGAAACAGG - Intergenic
987937921 5:24492244-24492266 TCCAATACTCATGAAGAAAATGG + Intronic
988180119 5:27780301-27780323 TTTTATAAGTTTGAAGAAAATGG - Intergenic
988279853 5:29130781-29130803 TTAAAGAAGCATGTAAAAAAAGG - Intergenic
988371947 5:30381576-30381598 TTTCAGAAAAATGAAGAAAATGG + Intergenic
988699328 5:33657693-33657715 TTTAATAAACATAAGTAAAACGG + Intronic
988888015 5:35580787-35580809 GAAAATAAGAATGAAGAAAAAGG + Intergenic
989119820 5:37993233-37993255 TTTGATAAGCATGAAGATGGAGG - Intergenic
989769468 5:45126629-45126651 TTTAATAGTCTTCAAGAAAATGG + Intergenic
989802193 5:45556585-45556607 TTAAATAGGAATGGAGAAAATGG - Intronic
989954291 5:50338542-50338564 TTTGAAGAGGATGAAGAAAAGGG - Intergenic
990078982 5:51888728-51888750 TTTATTAAGAATAAAAAAAAAGG - Intergenic
990655763 5:57953365-57953387 GTTAATAAGCAGGAAAAAATGGG + Intergenic
991266227 5:64721516-64721538 TATATTAAGTATGAAGAAATAGG + Exonic
991569530 5:68039955-68039977 TTTAATTAGCAGGATGACAAAGG + Intergenic
992230633 5:74660024-74660046 TTTACTCAGCAAGAAGCAAAGGG + Intronic
992331268 5:75719229-75719251 TATAATAAGCATGAAAAAAAAGG - Intergenic
993021406 5:82595884-82595906 TTTAGTAAACAGGAAGGAAAAGG - Intergenic
993031572 5:82712706-82712728 TCTAATTTGCAAGAAGAAAATGG + Intergenic
993077746 5:83255418-83255440 TAAAATTGGCATGAAGAAAAAGG - Intronic
993223141 5:85129345-85129367 TATATTAAGCACGAAAAAAAAGG - Intergenic
993632529 5:90303244-90303266 TTAAAAAGGCAAGAAGAAAATGG + Intergenic
993665365 5:90688881-90688903 ATAAATAAGCAAGAAGATAAAGG - Intronic
994301309 5:98151309-98151331 TTTGATCAGCATGTAGAGAAGGG + Intergenic
994328991 5:98484078-98484100 TTTTATCAGCCTGAAGATAAGGG - Intergenic
994382410 5:99087054-99087076 TTTAATAGGCATGACAAAACTGG + Intergenic
994401236 5:99282342-99282364 TTTAAAAAGGAGGGAGAAAATGG - Intergenic
995017466 5:107327248-107327270 ATTTATAAGCATAAAGGAAAAGG - Intergenic
995356574 5:111243973-111243995 TTTAATACAGATGAAGAAACCGG + Intronic
995502273 5:112820495-112820517 TTTAAAAAGCATAAGAAAAAAGG + Intronic
995618657 5:113997932-113997954 TTTAATAAGGGTGAAAAATAAGG - Intergenic
995738576 5:115329837-115329859 TTTAATAGGCAAGAAAGAAACGG - Intergenic
995835755 5:116397837-116397859 TTTAAGTAGCATGAACACAAAGG + Intronic
996226075 5:120998114-120998136 GTTGATGATCATGAAGAAAATGG - Intergenic
996261156 5:121470833-121470855 TTTTAAAAACATAAAGAAAAAGG - Intergenic
996813737 5:127550095-127550117 TTTAATAAGAATAGGGAAAAAGG + Intronic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
997036375 5:130197228-130197250 TTTGAGGAGCATTAAGAAAAAGG + Intergenic
997080094 5:130727788-130727810 ATCAATAATCATGAATAAAAGGG + Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997884547 5:137618354-137618376 TTTAAAAACCATGATGCAAATGG + Exonic
998197293 5:140085296-140085318 ATTAAAAAGTATGAAAAAAAAGG + Intergenic
999442157 5:151610517-151610539 TTTAAAAAGCAAAAAGAAACAGG + Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000440935 5:161262250-161262272 TTTAATCAAGATGAAGAAATAGG + Intergenic
1000668016 5:164023030-164023052 CTTGACAAGCATAAAGAAAAGGG + Intergenic
1000683989 5:164224271-164224293 TAAAATAAGCATTCAGAAAAAGG - Intergenic
1001246299 5:170107769-170107791 TTTAAGAAGGATGAAGAACTGGG - Intronic
1001750934 5:174130906-174130928 TTAAAAAAGTATGAAGTAAATGG + Intronic
1003205521 6:4006822-4006844 TTAAAAAAGCATGAACAATAAGG + Intergenic
1003209884 6:4053050-4053072 ATTGACAAGTATGAAGAAAAAGG + Intronic
1003317799 6:5027571-5027593 TTTTATCAGCAGAAAGAAAAAGG - Intergenic
1003329569 6:5118676-5118698 TATAAAAAGCATGATAAAAATGG - Intronic
1003482967 6:6549963-6549985 TTTAAAAAGCAAAAAGAAACTGG - Intergenic
1003509237 6:6765598-6765620 TTTAGGATGCATCAAGAAAATGG - Intergenic
1003509492 6:6767695-6767717 TTTAGGATGCATCAAGAAAATGG + Intergenic
1004041481 6:11982024-11982046 TTTACTAATCATGTAGATAATGG + Intergenic
1004129311 6:12903643-12903665 ATTAAGAAGCATGAGTAAAATGG + Intronic
1004188000 6:13438287-13438309 TTACATAAGAATGAAGAGAAAGG + Intronic
1004538959 6:16530876-16530898 TATAATAAGCATTGAGATAATGG - Intronic
1004815566 6:19308550-19308572 TTTAATAAGCATTAATAGAATGG + Intergenic
1005051662 6:21689596-21689618 TTTAATAGGCAAGAAAAAAGGGG + Intergenic
1005165299 6:22913026-22913048 TTACATAAACATGAAGAAAAGGG - Intergenic
1005420986 6:25650886-25650908 GTTAATAATAATGAAAAAAATGG - Intergenic
1006277201 6:33014733-33014755 TTTAAAAAGCAATAAGAAACAGG - Intergenic
1007181514 6:39932377-39932399 TTTTATAAACATGAAGCAAAGGG + Intronic
1007850445 6:44797791-44797813 TTTAATTTGCAACAAGAAAAAGG + Intergenic
1008521793 6:52368483-52368505 TTTAAAAAAAAAGAAGAAAAGGG + Intronic
1008561596 6:52729931-52729953 TTTCCTAAGCAGGCAGAAAAGGG + Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1009049286 6:58259088-58259110 TTTAATATCCAAGATGAAAAAGG - Intergenic
1009224827 6:61012175-61012197 TTTAATATGCAGGGAGAAAAGGG - Intergenic
1009224844 6:61012323-61012345 TTTAATATCCAAGATGAAAAAGG - Intergenic
1009225799 6:61019249-61019271 TTTAATACCCAGGGAGAAAAAGG - Intergenic
1009301159 6:62022993-62023015 TTTTAAAAGCTTGAACAAAAGGG + Intronic
1009319161 6:62264791-62264813 TATAATAAGCAATAGGAAAAAGG - Intronic
1010044991 6:71431229-71431251 TTTTATGAGTATGAAGGAAAGGG - Intergenic
1010318393 6:74477288-74477310 TTTAATATGAATAAAGAACAAGG - Intergenic
1010762281 6:79737260-79737282 TTTGATAAGCGTTAAAAAAAGGG - Intergenic
1010791460 6:80069946-80069968 TCATATAAGGATGAAGAAAATGG - Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011461390 6:87608896-87608918 AATAATAACCAAGAAGAAAAAGG - Intronic
1011584016 6:88904656-88904678 CTCAATAAGCTTGCAGAAAAAGG + Intronic
1011911046 6:92439122-92439144 TTTAATAAAAATGGAGAAAATGG + Intergenic
1011925267 6:92635472-92635494 GTTAATAATAATGAAGAATATGG - Intergenic
1012026898 6:94007252-94007274 TTTTATATGCCTGAAAAAAAGGG + Intergenic
1012117189 6:95316751-95316773 TTTAATAAGAAAGAAGTAAATGG - Intergenic
1012139286 6:95602044-95602066 TTTAACAAGGAAAAAGAAAAAGG - Intronic
1012406406 6:98905178-98905200 TTTAAGAAACATGAAGTAAAGGG + Intronic
1012701247 6:102459563-102459585 TTGAATAAGAGTGAAGGAAACGG - Intergenic
1012855815 6:104500062-104500084 TTTAAAATGCATGAATGAAAGGG + Intergenic
1013132912 6:107252165-107252187 TTTAATCAGCATGCAGAGTAGGG - Intronic
1013718981 6:113000128-113000150 TTTAATAATGAGGAAGAAGAGGG + Intergenic
1013932874 6:115555947-115555969 TTTAAGAAGCATAAAAGAAATGG + Intergenic
1014465398 6:121750364-121750386 TATAATAAGGAAGAGGAAAATGG + Intergenic
1014508103 6:122283983-122284005 TTTAATAATCAGGAGGGAAAGGG - Intergenic
1014515202 6:122369229-122369251 TTGAATCAGAATTAAGAAAAAGG + Intergenic
1014560835 6:122888368-122888390 TTAAATTTGCATGAATAAAAAGG - Intergenic
1014627804 6:123751037-123751059 TTTAAAAAGCAAAAAGAAATAGG + Intergenic
1014714193 6:124844995-124845017 TTTCATAAACAGGATGAAAAAGG - Intergenic
1014998132 6:128178450-128178472 ATTAATACACATGAAAAAAATGG - Intronic
1015066392 6:129034281-129034303 TTTATTAAGCATGAAGTGATTGG + Intronic
1015372247 6:132467216-132467238 TTTAATGAGCAAGAAGGAGATGG - Intronic
1015515341 6:134077843-134077865 TTTAATAAATAAGAAGAAACAGG + Intergenic
1015725839 6:136298489-136298511 TTTAATAAACAAGAAGAATAAGG + Intergenic
1015860534 6:137673972-137673994 TGCAATAATCATGATGAAAAAGG - Intergenic
1015874027 6:137804386-137804408 TTTCAGAAACAAGAAGAAAAGGG + Intergenic
1016049686 6:139518064-139518086 TTTTATCAGCTTGAAGAAGAGGG - Intergenic
1016659832 6:146565620-146565642 TGTTATAAGCTAGAAGAAAATGG - Intergenic
1016733214 6:147448639-147448661 TTTAACAAGCAAGAAGGAAGGGG - Intergenic
1016898432 6:149076887-149076909 TTTAAGAAGAAAGAAAAAAATGG + Exonic
1017015477 6:150096129-150096151 TGTAATAAACATCAAGAGAAGGG - Intergenic
1017457530 6:154615508-154615530 TTTAAAAATCAAGAAGCAAAGGG - Intergenic
1017982923 6:159417904-159417926 TTTAACAAGGAGGAAGAATAAGG - Intergenic
1018386407 6:163308129-163308151 TTTAATATGAATTAAGAAAGGGG - Intronic
1019085459 6:169471471-169471493 TTTAAAAACCATCAAGAAAAAGG + Intronic
1019130885 6:169873510-169873532 TTCAATAAGACTGAAGAGAAGGG - Intergenic
1019736686 7:2653404-2653426 TTTAAAAAAATTGAAGAAAATGG + Intronic
1019999332 7:4746217-4746239 TTTAAAAATCATGATTAAAAGGG - Intronic
1020400291 7:7769455-7769477 TCTAAGGCGCATGAAGAAAAGGG - Intronic
1020553086 7:9632494-9632516 TTTGATGTCCATGAAGAAAACGG - Intergenic
1020844356 7:13263767-13263789 TTTAAGAAGCTTGACGATAAAGG - Intergenic
1020861680 7:13501032-13501054 TGGAATCAGGATGAAGAAAAGGG + Intergenic
1021060709 7:16106720-16106742 TTTAATAATTATGAAGAATAAGG + Intronic
1021160237 7:17263751-17263773 GTCAATAACCATGAAGAAATAGG - Intergenic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021324397 7:19247599-19247621 TTGAGGAAGTATGAAGAAAAAGG + Intergenic
1021619422 7:22536851-22536873 ATTTATAAGTATGTAGAAAAGGG + Intronic
1021657374 7:22885326-22885348 CTTAATAAAGAAGAAGAAAACGG - Intergenic
1021737087 7:23650162-23650184 TTTGAAAAGCATAAAAAAAATGG - Intergenic
1021965233 7:25911782-25911804 TTCAAAAAGAATAAAGAAAAGGG + Intergenic
1021974510 7:25998610-25998632 TTTAAGAACCGTGAAGGAAATGG - Intergenic
1022272356 7:28821201-28821223 TTTTATAAGAGTGCAGAAAAGGG + Exonic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022762509 7:33370866-33370888 TTTAAGAAGCAAGTAGAACAAGG - Intronic
1024193075 7:47032331-47032353 TTTAATAGGCAAGAAGTGAAGGG - Intergenic
1024439358 7:49398131-49398153 TTTAATCTAAATGAAGAAAATGG + Intergenic
1024794587 7:53005950-53005972 TTTAGTAAGCATGAGGATACTGG - Intergenic
1024909715 7:54432415-54432437 ATTAATAATCATGCAGATAAAGG + Intergenic
1025762676 7:64409227-64409249 ATTAAAAAGAAAGAAGAAAAAGG + Intergenic
1025762866 7:64410925-64410947 ATTAAAAAGAAAGAAGAAAAAGG - Intergenic
1025968147 7:66294883-66294905 TTTAAAAAGCATGCACACAATGG - Intronic
1025975469 7:66366099-66366121 TTTAAGAAGGAGGAAGAAATGGG - Intronic
1027760306 7:82269436-82269458 GTTATGAAGCAGGAAGAAAATGG - Intronic
1027796722 7:82704011-82704033 TGTAATAAGAAGGAAGAAGATGG + Intergenic
1028066090 7:86386464-86386486 TATTTTAAGCATGAAGAAAAAGG - Intergenic
1028073376 7:86479876-86479898 TTTAATGTGGATGAACAAAATGG + Intergenic
1028277750 7:88878655-88878677 TGAAATAATCATGAAGAAATTGG + Intronic
1028330729 7:89588229-89588251 ATTTATAAACATAAAGAAAATGG + Intergenic
1028337622 7:89676973-89676995 TTGAATAAGAATGTTGAAAAAGG - Intergenic
1028371838 7:90100737-90100759 ATTTATAAGTATGTAGAAAAGGG - Intergenic
1028567732 7:92251262-92251284 TTTAAAATCCATGAAGAGAAGGG + Intronic
1029663925 7:101982011-101982033 TAAAATAAGCAAGCAGAAAAGGG + Intronic
1030078358 7:105756070-105756092 TTTAAAAGGCATGCAAAAAATGG - Intronic
1030435974 7:109521107-109521129 TTTCATAAGCATGAAAAAGAAGG - Intergenic
1030617034 7:111748404-111748426 CTTAAAAACCAGGAAGAAAAAGG + Intronic
1030985990 7:116243070-116243092 CATAATAAGCCTGAAGTAAAAGG - Intronic
1031335151 7:120519834-120519856 TTAAATAAATATGAAGCAAATGG - Intronic
1031600069 7:123697186-123697208 TTTATTAGTCAAGAAGAAAAAGG + Intronic
1031914282 7:127547598-127547620 TTTAAACAGAATGAAGAAAAGGG - Intergenic
1032818329 7:135500128-135500150 TATAATAACAATAAAGAAAATGG + Intronic
1032869644 7:135970129-135970151 TTAAATAAACATCCAGAAAATGG + Intronic
1032995437 7:137440970-137440992 TTTAATGATAATGAAAAAAACGG + Intronic
1033054209 7:138034796-138034818 CTTTATAAGCATCATGAAAACGG - Intronic
1033193065 7:139300973-139300995 TTAAAACAGCCTGAAGAAAAAGG + Exonic
1033463951 7:141573822-141573844 TATAATAATAATAAAGAAAAAGG - Intronic
1033545233 7:142393482-142393504 TTTTTTAAAAATGAAGAAAAGGG + Intergenic
1033792502 7:144807846-144807868 TTTAAAAGGCATCAATAAAAAGG + Intronic
1033830324 7:145243554-145243576 TTTTATAAGCATTAAAAAAGGGG + Intergenic
1033899510 7:146117477-146117499 TTTAATAAGCAAGTACTAAATGG - Intronic
1034140736 7:148813253-148813275 TTTATTAAGCATGTAAAAATAGG - Intronic
1034589385 7:152127160-152127182 GTGAATAAGAATAAAGAAAAAGG + Intergenic
1034703243 7:153115729-153115751 TTTGATAAGAAAGAAGAAAAAGG + Intergenic
1035199541 7:157252405-157252427 TTTAATCAGAATGAAGACAATGG + Intronic
1035638865 8:1167369-1167391 GTTGCTAAGCAGGAAGAAAAAGG + Intergenic
1035941229 8:3903579-3903601 TGAACTAAGTATGAAGAAAAAGG - Intronic
1036032639 8:4991313-4991335 ATTAATAATCCAGAAGAAAAAGG + Intronic
1036205789 8:6805037-6805059 TTTCATATGCATGAAGAGAGAGG + Intergenic
1036293878 8:7519234-7519256 TTTAGTAATCATGAACAGAATGG - Intergenic
1036328683 8:7801757-7801779 TTTAGTAATCATGAACAGAATGG + Intergenic
1037030073 8:14093635-14093657 TTTAAAAAGCATCAAAAAAGTGG - Intronic
1037252328 8:16910952-16910974 TTTAATAAGTATTATGATAATGG - Intergenic
1037282956 8:17263993-17264015 TTAAATAGGCATGTAGAACATGG - Intronic
1037575022 8:20194260-20194282 CTTAATATGCAAGAAGGAAAAGG - Intergenic
1037625001 8:20598961-20598983 GTTAGTAAGTATGAAGAAAGGGG + Intergenic
1039218612 8:35301845-35301867 TGTAAAAAGAATGAAGGAAATGG + Intronic
1041984292 8:63902585-63902607 TGTAATAGGCAGGAAGAAAAAGG - Intergenic
1041992015 8:64004600-64004622 TTTTATAATCATGACGCAAAGGG + Intergenic
1042254404 8:66788442-66788464 TCTAACAAGCACCAAGAAAAGGG - Intronic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1043068156 8:75602783-75602805 TTTAATCATCATCAGGAAAATGG + Intergenic
1043094449 8:75948842-75948864 TATAATAAGCTAGAAGAAAATGG + Intergenic
1043252600 8:78094102-78094124 TTTTATGAACATGAAGAAATAGG - Intergenic
1043538106 8:81228273-81228295 TTTATTTAGCATCAAGAAAAGGG + Intergenic
1043990386 8:86745887-86745909 TCTAATCAGCAAGAAGATAAGGG + Intergenic
1044038893 8:87340939-87340961 TATAAGAAACATGAAAAAAATGG - Intronic
1044343706 8:91077891-91077913 TTTAAAAAGCTTGATAAAAAGGG + Intronic
1044354122 8:91201057-91201079 ATTAATATTCATGAACAAAAGGG - Intronic
1044733337 8:95250954-95250976 TTTCAATAGCATAAAGAAAAGGG - Intronic
1044853806 8:96454200-96454222 TTCAATTAGCTTGAATAAAAGGG - Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046084757 8:109418348-109418370 TTTATGAACCCTGAAGAAAATGG + Intronic
1046104960 8:109653984-109654006 GTTAATAACCATAAAGAACATGG + Intronic
1046416723 8:113924949-113924971 CCTAAAAAGCATGATGAAAAAGG + Intergenic
1047583297 8:126240944-126240966 TTGTATAACCATGAAAAAAACGG + Intergenic
1048034072 8:130660477-130660499 TTTAACAATCATGCAGAAATGGG + Intergenic
1048247706 8:132826844-132826866 TCTAATAAATATGAAAAAAATGG - Intronic
1048480345 8:134784282-134784304 TTGAAATAGCAGGAAGAAAAAGG - Intergenic
1048651103 8:136478746-136478768 TATAATAAGAATAAAGGAAAGGG + Intergenic
1049588626 8:143443891-143443913 TTCTATAACCATGAAGAAATTGG + Intronic
1050282068 9:4060786-4060808 TTTAATAAGCAACAGAAAAATGG + Intronic
1050586971 9:7123205-7123227 TATCCTAAGCAGGAAGAAAATGG + Intergenic
1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG + Intergenic
1051805590 9:20989520-20989542 TTTAAAATGCATGAAGAAGCTGG + Intronic
1051868817 9:21713609-21713631 TTCCATAAGTAGGAAGAAAAAGG + Intergenic
1052133416 9:24879950-24879972 TCTAATAACCATGGGGAAAAAGG - Intergenic
1052198948 9:25754067-25754089 GTCAAGAAGTATGAAGAAAATGG + Intergenic
1052305914 9:27009719-27009741 TTTATTAAGCAGGAAGGAAAAGG - Intronic
1052320497 9:27162645-27162667 TGTTAAAAGCATCAAGAAAATGG + Intronic
1052615677 9:30837648-30837670 TTCAATAAATATGAATAAAATGG - Intergenic
1053706795 9:40762392-40762414 TATCAGAAGCATGAATAAAATGG + Intergenic
1054416709 9:64883158-64883180 TATCAGAAGCATGAATAAAATGG + Intergenic
1054865486 9:69996141-69996163 GATAATAAGCAAGAAAAAAAAGG + Intergenic
1054896761 9:70322242-70322264 TTGAATAGGAATGAAGGAAAGGG - Intronic
1054945283 9:70789302-70789324 CTTTATGAGCATAAAGAAAATGG - Intronic
1055054003 9:72007010-72007032 TTTAATAGCCATTAAAAAAACGG - Intergenic
1055126861 9:72728842-72728864 TTTAATCAGCAGGTAGAAAAAGG + Intronic
1056697340 9:88871198-88871220 TTTAAAAAGGATGAAACAAATGG - Intergenic
1057142017 9:92732564-92732586 TTAAATCAGCCAGAAGAAAAAGG + Intronic
1057415036 9:94854269-94854291 TCTTATAAAAATGAAGAAAATGG + Intronic
1057561491 9:96131388-96131410 TTTTAAAACCATGAAGCAAAGGG - Intergenic
1058268328 9:102936129-102936151 TCTATTAAGCATTAAGAAAGTGG + Intergenic
1058750359 9:108033248-108033270 TTTAATGAGGATGGAGAAAGTGG - Intergenic
1059879672 9:118676671-118676693 TTTTATGTGCATCAAGAAAATGG + Intergenic
1060772902 9:126345779-126345801 TTTCAGAAACATGAAGAAAGAGG - Intronic
1061109208 9:128555403-128555425 TTTGACGAGCATGCAGAAAACGG + Intronic
1061129187 9:128698495-128698517 TTTAATAGGCCTGAGGCAAAGGG + Intergenic
1203365652 Un_KI270442v1:252886-252908 TTTAAAAATCAAGAAAAAAATGG - Intergenic
1185962806 X:4564202-4564224 TCGAATTAGGATGAAGAAAATGG - Intergenic
1186307130 X:8273938-8273960 TTTTCTATGAATGAAGAAAATGG + Intergenic
1187260358 X:17679841-17679863 TTTAACCAGAATGAAGAAAGGGG + Intronic
1187662581 X:21566381-21566403 TTAAATAAGCATGTATAAACAGG - Intronic
1187942327 X:24394106-24394128 TTTAATAAACAATAAGAAAAAGG - Intergenic
1187980556 X:24752534-24752556 TTTTTAAACCATGAAGAAAAGGG + Intronic
1188122384 X:26324504-26324526 TTAAATAATAATGTAGAAAAGGG - Intergenic
1188337839 X:28960278-28960300 TTCAAAAAGCATTAGGAAAAGGG + Intronic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188990720 X:36816738-36816760 TCTAGTAAGAATGAGGAAAAGGG + Intergenic
1190375171 X:49782253-49782275 TTTTATAAGCAACAAAAAAATGG - Intergenic
1190384261 X:49869068-49869090 TTTACTTAGCAGGTAGAAAAGGG + Intergenic
1190436149 X:50427759-50427781 TTTAATAAGCAAGCAAAAACAGG + Intronic
1190499140 X:51057936-51057958 TCTAAAAACCTTGAAGAAAATGG - Intergenic
1190633078 X:52407898-52407920 TTACATAATCCTGAAGAAAATGG - Intergenic
1190638603 X:52461170-52461192 TTAAACAATCTTGAAGAAAATGG + Intergenic
1190678051 X:52799257-52799279 TTAAACAATCTTGAAGAAAATGG - Intergenic
1190791639 X:53706117-53706139 GTTTATAGGCAGGAAGAAAATGG + Intergenic
1192307049 X:69972393-69972415 TTTCTTGAGCAAGAAGAAAAGGG - Intronic
1192373920 X:70539690-70539712 TTTATTTAGCAGGAAGAATAGGG - Intronic
1192402076 X:70845942-70845964 TTTAATATGTGTGATGAAAAGGG - Intronic
1192557174 X:72099696-72099718 TTTAAAAAGTAAAAAGAAAAAGG + Intergenic
1192678759 X:73229519-73229541 TTGAATAAGCCTGAAGGAAAAGG - Intergenic
1192734022 X:73831369-73831391 TTCAATCCACATGAAGAAAAGGG - Intergenic
1192905812 X:75548740-75548762 TTTAATATGGCTGTAGAAAAGGG - Intergenic
1193649430 X:84111504-84111526 TTTAACAAGCCAGAAGAGAATGG + Intronic
1193668681 X:84356417-84356439 AATATTAAGCAAGAAGAAAATGG + Intronic
1194390086 X:93306403-93306425 TTTAAAAAGCAAGAAGGACATGG - Intergenic
1194869778 X:99115015-99115037 TTAAAGAAGGATAAAGAAAAGGG + Intergenic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1195828587 X:109030443-109030465 TTTAATAAGCCAGGAGAGAATGG + Intergenic
1195890802 X:109692511-109692533 TTTATTAAACATAATGAAAAAGG + Intronic
1196315543 X:114218467-114218489 TTTTATATGCATGAAATAAAAGG + Intergenic
1197342454 X:125289252-125289274 AGAAATAAGCAGGAAGAAAAGGG - Intergenic
1197400610 X:125984503-125984525 TATAAGAAGCATGAAGAATCAGG + Intergenic
1198218613 X:134579393-134579415 TTTAATCACCATGAAAGAAAAGG + Intronic
1198252640 X:134895475-134895497 TTTAATAACCAAGAATAATAAGG - Intronic
1198266027 X:135009706-135009728 TTTTACAATCATGAATAAAAGGG + Intergenic
1198297155 X:135298231-135298253 ATAAATGAGAATGAAGAAAAGGG + Intronic
1199714109 X:150494092-150494114 TTTAATAAGGAAGTAAAAAATGG + Intronic
1199907385 X:152247199-152247221 TTTAATAATCAAGAGGAAAGTGG - Intronic
1199938559 X:152601629-152601651 TTTAGTAAGCAAGAAAAAAGTGG + Intergenic
1199970785 X:152859326-152859348 TTTATTAGGGAAGAAGAAAAAGG - Intronic
1200322934 X:155208737-155208759 TTTAATAAGCATCAATTGAAAGG - Intronic
1200598184 Y:5173424-5173446 TTTCATAAGCAGACAGAAAAAGG + Intronic
1200755129 Y:6984017-6984039 CTTAATAAGCTTAGAGAAAATGG + Intronic
1201368690 Y:13236981-13237003 TTAAATAAGAATGATGAAAATGG - Intergenic