ID: 1127302060

View in Genome Browser
Species Human (GRCh38)
Location 15:57664384-57664406
Sequence CTCCTCTCCTAGGGAATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127302060 Original CRISPR CTCCTCTCCTAGGGAATCAG AGG Intronic
900984212 1:6064229-6064251 CCCCTGACCTACGGAATCAGTGG - Intronic
901798869 1:11695782-11695804 CTCCTCTCCTAGGCAATTTGTGG - Intronic
902173951 1:14635429-14635451 CACCTCTCATAGGGTATGAGGGG - Intronic
903737385 1:25538677-25538699 GTACTCTCCTAGGGAGTCAGAGG - Intergenic
910174694 1:84416879-84416901 CTCCTCTCCTTCAGATTCAGGGG - Intergenic
911128070 1:94360090-94360112 CTCCTCTTCTGGGAAAGCAGTGG + Intergenic
916739541 1:167636241-167636263 CACCTCTCTTAGGGACTCATTGG - Intronic
917486014 1:175455251-175455273 CTCCTCACCCATGGAATCTGTGG + Intronic
920615059 1:207483711-207483733 CTCCTCTTTTAGTGAGTCAGGGG - Intronic
922920786 1:229301182-229301204 CTCCTCTCCTGAGGAAGCACAGG + Intronic
923205392 1:231753895-231753917 CCCCTGCCCTAGGGAATCTGTGG - Intronic
923906753 1:238393725-238393747 CTCCTCTCCTTGAGCATCTGTGG - Intergenic
1063242364 10:4184222-4184244 GTCCTCTCCTAGGGAGTCCCTGG - Intergenic
1066667409 10:37798776-37798798 CTCCCCTTCTAGGGAATTATAGG - Intronic
1067062160 10:43083092-43083114 CTCCTCACCCAGGGAAACAACGG + Intronic
1068576497 10:58689713-58689735 CTCAGCACCTTGGGAATCAGTGG - Intronic
1070814916 10:79317006-79317028 CTCCCCTCCTAGGGAAGCTTGGG + Intergenic
1071431891 10:85612972-85612994 CTGCTCTCCCAGCGCATCAGGGG - Intronic
1072895156 10:99360167-99360189 CTCCACTGGGAGGGAATCAGGGG - Intronic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1075322731 10:121505153-121505175 CTCTTCTCACAGGGAACCAGAGG + Intronic
1075349932 10:121715112-121715134 CCCCTCCCCAAGGGAATTAGTGG + Intergenic
1075441684 10:122484878-122484900 CTACTCTCCAAGGGGTTCAGGGG - Intronic
1076322181 10:129591388-129591410 CTCCTTTCCTGGGGAGACAGAGG - Intronic
1079448986 11:20582900-20582922 CTTCTCCCCTAGGGACTCTGTGG + Intergenic
1079720549 11:23806496-23806518 CTCCTTTCAAAGGGAATCAGTGG + Intergenic
1080386934 11:31815980-31816002 TTCCTCTCGTGAGGAATCAGAGG - Intronic
1080628756 11:34053145-34053167 CTTCTCTCCTACGGAAGAAGAGG - Intronic
1081772875 11:45660552-45660574 CTCCTCTCCCAGGGCAGGAGAGG + Intronic
1087137375 11:94734645-94734667 CTCCTCTCCCAGGGGAGCATGGG - Intronic
1089951874 11:122535543-122535565 CCCCTGCCCTAGGGAATCTGTGG + Intergenic
1090050479 11:123373753-123373775 CTCCTATTCTAGGGAGGCAGAGG - Intergenic
1090535338 11:127635140-127635162 CTCCTCTTCTAAGAAACCAGAGG + Intergenic
1090625260 11:128602880-128602902 CTCATCTCCTTGGGACTCAAAGG - Intergenic
1091385274 12:90805-90827 CTCCTCACCCCAGGAATCAGAGG + Intronic
1095403524 12:41842183-41842205 CTCATCTTCTAGGTAGTCAGTGG - Intergenic
1096553833 12:52391202-52391224 CTCCTCTCCTGGGGAGGAAGGGG + Intergenic
1096829560 12:54303855-54303877 CTCCTCTCCTACAGAAAAAGAGG + Intronic
1101652928 12:106694213-106694235 CTTCTCTCCTAGGAAGTCAGAGG + Intronic
1103045151 12:117729969-117729991 CTCCTATCCTAGCTAATAAGTGG - Intronic
1106125371 13:26896499-26896521 CTCCTCACATATGGAATCAGTGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108765780 13:53627709-53627731 CACATATCCTAGGGAAGCAGAGG + Intergenic
1109673930 13:65647994-65648016 CTCCTCTGCTACAGATTCAGTGG - Intergenic
1117968328 14:61228197-61228219 CTTCTCTCCTCGGGATTCAATGG - Intronic
1118727029 14:68636212-68636234 CTCCTGTTCTCTGGAATCAGAGG - Intronic
1121243914 14:92449370-92449392 CTCCTCTCTTAGGGCACCTGTGG - Intronic
1121904420 14:97726654-97726676 CACTTCTACTATGGAATCAGGGG + Intergenic
1121906555 14:97751566-97751588 TTCCTCTCACAGGGAATGAGGGG + Exonic
1126377513 15:48010985-48011007 CTCCTCGCCTGTGGAATCAATGG + Intergenic
1126909633 15:53403996-53404018 CTCCCCTCCTAGGAAGTCAGGGG - Intergenic
1127302060 15:57664384-57664406 CTCCTCTCCTAGGGAATCAGAGG + Intronic
1130330330 15:82917443-82917465 CTCCTCTCCCAGGGCCCCAGGGG + Intronic
1130823818 15:87522966-87522988 CTCTCCCCCTAGGGAATAAGCGG + Intergenic
1131743243 15:95417182-95417204 CTCCCCTCCTAGGGAACCCTGGG - Intergenic
1132724151 16:1331661-1331683 GTCCTCTCCTGGGGAAACGGAGG + Intergenic
1132785563 16:1655454-1655476 CTCCACACCCAGGGAATAAGGGG - Intronic
1133197246 16:4179838-4179860 CTCTTCTCCTTGGGACTCGGAGG - Intergenic
1133263156 16:4565358-4565380 CTCCTGTCCTGGGGAAGAAGGGG - Intronic
1134376642 16:13682094-13682116 CCCTTCTCCTAGTTAATCAGAGG + Intergenic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1136069833 16:27781126-27781148 CCCGTCTCTTAGGAAATCAGAGG - Intergenic
1140890694 16:79282295-79282317 CTCCTCTCCCAGGGAACTTGGGG - Intergenic
1141041523 16:80676532-80676554 CTCCTCACCCAGAGAAGCAGTGG + Intronic
1143496900 17:7317610-7317632 CTCCTCCACTGGGGAGTCAGTGG - Intronic
1143521508 17:7446818-7446840 GTCCACTCCTAGTGAAGCAGAGG - Exonic
1143844752 17:9765703-9765725 CTCCACTCCTAGGGAAGGAGGGG - Intergenic
1144460888 17:15457842-15457864 CTCCTCTCCCAGGGAAACATGGG + Intronic
1144737467 17:17563179-17563201 CTTCTCTCCGAGGGCCTCAGGGG - Intronic
1144885956 17:18461898-18461920 CTCCTCTTCTAGGGTAGCAAAGG - Intergenic
1147169475 17:38609550-38609572 CTCCTCTCCTATGGAGTGGGAGG - Intergenic
1151515478 17:74592216-74592238 CTCCTCTCCTTGGTGATCACAGG + Exonic
1157173518 18:45429903-45429925 GTCCTTCCCTAAGGAATCAGAGG + Intronic
1157404334 18:47410533-47410555 CTCCCCTCCTAGGGGAGCTGTGG - Intergenic
1160533603 18:79579267-79579289 CGACTCTCCTGGGAAATCAGGGG - Intergenic
1161351756 19:3796810-3796832 CTACTCTCCTGGGTAATTAGAGG + Intronic
1164695681 19:30241856-30241878 CTCCTCACCTGGGTAGTCAGTGG + Intronic
1164769005 19:30793521-30793543 CACCTTTGCTAGGGAATCCGAGG + Intergenic
1165843274 19:38802221-38802243 CTCCTCCTTTAGGGATTCAGAGG - Intronic
1165946463 19:39445792-39445814 TTCTTCTCCCAGGGAACCAGCGG + Exonic
1168280590 19:55303475-55303497 CTTCTTTCCTTGGGAATCTGGGG - Intronic
1168564426 19:57411487-57411509 CTCCTCTCTTTGGGACACAGGGG - Intronic
925724990 2:6863979-6864001 GTCCTCTCCTAGCCATTCAGGGG + Intronic
926131624 2:10306412-10306434 CTGCTCTCCTATGGTAGCAGGGG + Intronic
928172369 2:29011960-29011982 TTCCTCACCTAGAGAATGAGAGG + Intronic
934713098 2:96528181-96528203 CTCCTCCCCTTGTGACTCAGTGG - Intergenic
934799207 2:97134996-97135018 ATCCTCTCCTAGGGAAGATGCGG - Intronic
935198315 2:100834170-100834192 TTCCTCACCTGGAGAATCAGGGG + Intronic
936874402 2:117171484-117171506 CTGCTGCCCTAGGGAATCTGCGG + Intergenic
939529247 2:143336694-143336716 CTCCTCTCCTAGGGCATACCTGG - Intronic
940665947 2:156609873-156609895 CTCCTCTCCAAGAGTATCAGAGG + Intronic
940986513 2:160057118-160057140 CCCCTCTCCTAGGAAATTAAGGG + Intronic
942623366 2:177872354-177872376 CTCCTCTTCCAGGGTATCACTGG - Intronic
943088264 2:183342408-183342430 ATCCACTCCTAGGTATTCAGAGG + Intergenic
946835128 2:223764737-223764759 CTCCTTTCCCAGGGAAGCATAGG + Intronic
948119538 2:235518898-235518920 CTCCTGTCCTTGGGCCTCAGTGG + Intronic
1169308541 20:4515850-4515872 CCCCTCTCCAAGGGAATGATAGG + Intergenic
1171345917 20:24466333-24466355 TTCCTCACCTGTGGAATCAGAGG + Intergenic
1174738391 20:52987112-52987134 CTCCTCTCCCAGGATATCAGCGG + Intronic
1175161342 20:57010005-57010027 CTCCCGTCCTGGGGCATCAGGGG - Intergenic
1175523268 20:59616540-59616562 CTCCCCCACTAGGAAATCAGGGG - Intronic
1175769011 20:61611212-61611234 TTCCTCTCCCTGGGGATCAGAGG + Intronic
1178303347 21:31470787-31470809 CTCTTCTCCTGGGGAGACAGTGG - Intronic
1178426563 21:32483499-32483521 CTCCACTCCCAGGCAGTCAGGGG + Intronic
1178558196 21:33612662-33612684 TTCATCTCCTAAGTAATCAGGGG - Intronic
1179886047 21:44314648-44314670 CTCCACCCCAAGGGAACCAGAGG - Intronic
1182423551 22:30260191-30260213 CTCCTCTCCTGGGCAGTGAGAGG + Intergenic
1184426576 22:44412276-44412298 CTCCTCTCCTGGGGAATAGGAGG + Intergenic
1184446511 22:44550667-44550689 CTACTCTCCTAGCTGATCAGTGG + Intergenic
1184796508 22:46736432-46736454 CTCCCGTCCTAGGGATGCAGGGG - Intronic
1185195305 22:49465565-49465587 CCCCTCACCGAGGGACTCAGCGG + Intronic
950204062 3:11064445-11064467 CCTCTCTCCTTGGGAAGCAGAGG - Intergenic
954302478 3:49707196-49707218 CTTCTCTCCCAGTGCATCAGGGG + Intronic
954411234 3:50372075-50372097 CACCTCTCCCAGGGAATCCCTGG - Intronic
955160023 3:56455995-56456017 CTCCTGACCTAGGGAATTAGAGG + Intronic
956209806 3:66791190-66791212 CCCCAGTCCTAGGGAATCAAAGG + Intergenic
958005980 3:87812428-87812450 CCCCTGCCCTAGGGAATCTGTGG + Intergenic
958477881 3:94608405-94608427 GTCTTCTGCTAGGGAAACAGTGG - Intergenic
963490863 3:145998738-145998760 CTCCTCTCCCTGGAGATCAGGGG - Intergenic
964730615 3:159860829-159860851 AACCTGGCCTAGGGAATCAGGGG - Intronic
964870598 3:161310315-161310337 CTCCTCTTTCAGGGAATAAGTGG + Intergenic
967225360 3:187285926-187285948 CTCCTATCCCAGTGATTCAGAGG - Exonic
968237263 3:197040673-197040695 CCCTTCTCCTTTGGAATCAGAGG - Intergenic
969466202 4:7358016-7358038 CTCCTCTCCTTGGGAATGGGGGG - Intronic
974429522 4:61777884-61777906 CTACTCTCCTAGGGAAACATAGG + Intronic
977610664 4:99026681-99026703 CTCTTCTACTGGGGAATAAGAGG + Intronic
982086524 4:151841697-151841719 CTCCTCTTAGAGGGAACCAGTGG + Intergenic
984008424 4:174341805-174341827 CTTCTCTCCTAAGCTATCAGAGG - Intergenic
986169721 5:5305714-5305736 CTCCTCTGCTGGGGAACCTGGGG + Intronic
987859869 5:23470842-23470864 CTACTCTCCTAGGAATTCATTGG + Intergenic
988066475 5:26232671-26232693 CGCCTCTCCTAGGGAGTCCCTGG + Intergenic
990373620 5:55146704-55146726 CTCTTCCCCAAAGGAATCAGAGG + Exonic
991202229 5:64007941-64007963 CTCCTCTCCTAGACAGTGAGGGG + Intergenic
992045971 5:72889788-72889810 CTCCTCTTCTAGGGTAGCAAAGG - Exonic
993476791 5:88376380-88376402 CTCCTCTCCTTGAGTATAAGTGG + Intergenic
994212872 5:97105797-97105819 CTCGTTTCCTAGAGATTCAGTGG - Intronic
995709720 5:115022558-115022580 ATCCTTTCCCAGGGAATGAGAGG - Intergenic
995987670 5:118199383-118199405 ATCCTCTCCTAGGTACCCAGAGG - Intergenic
998226979 5:140334732-140334754 CTCCTCTCCTATGGTACCTGAGG + Exonic
999082963 5:148861497-148861519 CTCCTCACCAAAGGACTCAGAGG - Intergenic
1002182798 5:177440263-177440285 CTTCTCTCCCAGCCAATCAGAGG - Intronic
1002862160 6:1089225-1089247 CGCCTCTCCCAGTGAATCACTGG + Intergenic
1006598793 6:35212501-35212523 TTCCTTTCCTAGGGATTCAGTGG - Intergenic
1007693734 6:43718770-43718792 CTCCTGTCTCAGGGACTCAGTGG - Intergenic
1011337181 6:86274550-86274572 CTCCCCTCCTGGGAAGTCAGGGG - Intergenic
1013042346 6:106448287-106448309 CTCCTCTCAAGGGGAAGCAGAGG + Intergenic
1018208412 6:161456870-161456892 CTTTTCTCCTAGGCAAACAGAGG + Intronic
1019937473 7:4265802-4265824 CTCCTCTTCCAGAGAACCAGCGG + Exonic
1022164165 7:27740933-27740955 CTCCTGGCTTAGGGAATCTGTGG + Intronic
1022687384 7:32609398-32609420 TTCCTCTCCTAGTAAATGAGGGG - Intergenic
1023845947 7:44120456-44120478 CTCCTCTCCCACATAATCAGGGG - Intronic
1023929103 7:44694070-44694092 CTCCTCTCCTTGGGACACAGGGG - Intronic
1027360219 7:77400425-77400447 CTCCTCTGCTGTGGTATCAGTGG + Intronic
1027632647 7:80626005-80626027 CTGTTCTCCTGGGTAATCAGGGG + Intronic
1030436952 7:109534361-109534383 CTCTCCTCCTATGGAATCATTGG + Intergenic
1031749746 7:125556974-125556996 CTCCTGCTCTAGGGAATCTGTGG - Intergenic
1032487170 7:132296726-132296748 CTCAGCTCCTAGGGCCTCAGAGG + Intronic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033298013 7:140158891-140158913 TTCCTTTCCTAGGAAATGAGAGG - Intronic
1034139401 7:148802170-148802192 CTCCTCTCCTGGGGACACACTGG - Intergenic
1035642973 8:1197886-1197908 TTCCTCTCATGGGGAATGAGTGG + Intergenic
1038020117 8:23545554-23545576 CCCCTGTGCCAGGGAATCAGTGG - Intronic
1038747882 8:30269947-30269969 TCCCTTTCCTAGGGAATCATAGG - Intergenic
1043242675 8:77955781-77955803 ATCCTCTCCCAGGAACTCAGTGG - Intergenic
1044515862 8:93137644-93137666 CTCCTCTGCTGGTGAAACAGGGG + Intronic
1046289436 8:112137549-112137571 CCCCTCTCCTAGGCCTTCAGAGG + Intergenic
1047025758 8:120822559-120822581 TTCCTCTACCAAGGAATCAGTGG + Intergenic
1047064971 8:121271697-121271719 CTCCTCTCTTTGGACATCAGAGG - Intergenic
1048790096 8:138093913-138093935 CTCCTGATCTAGGGAATCTGTGG - Intergenic
1049156122 8:141067799-141067821 CTCCTCCCCTAGGGACAGAGAGG - Intergenic
1055954237 9:81759239-81759261 CTGCTGTCCCAGGGAAGCAGAGG - Intergenic
1057143130 9:92739389-92739411 CTCCCATCCTGGGGAATCACAGG + Intronic
1057796493 9:98161625-98161647 TTCCTCTGCTCAGGAATCAGAGG - Intronic
1059326195 9:113505321-113505343 CTCCTCTCCAAGGGAACTGGAGG - Intronic
1060235055 9:121856975-121856997 CCCCTCTCCTTGAGAATCAGGGG + Intronic
1060674163 9:125497097-125497119 CTCCTCTCCTGGGGCCTCAGGGG + Intronic
1062180405 9:135188399-135188421 CTCCTCTCCCAAGCAAGCAGTGG + Intergenic
1187438469 X:19294559-19294581 CTCCTCTGCCAGGGAACCAGAGG - Intergenic
1191711993 X:64159742-64159764 CTCCTCTCATTGTGACTCAGGGG - Intergenic
1192710689 X:73582365-73582387 CTTTTCTCCTAGGGAATCATTGG - Intronic
1196622189 X:117836522-117836544 TTTCTCTCCTAGGGACTCAGTGG + Intergenic
1199142933 X:144333506-144333528 CTCCTCTGCTGCGGAATCAGAGG + Intergenic
1200248818 X:154541476-154541498 CTGCTCTCCTCAGGACTCAGGGG + Intronic