ID: 1127303003

View in Genome Browser
Species Human (GRCh38)
Location 15:57675978-57676000
Sequence TCGAATCCTGGAATCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127303003 Original CRISPR TCGAATCCTGGAATCTTGAG TGG Intronic
901223216 1:7595927-7595949 TCTCATCCTGGAAGCTTGGGAGG - Intronic
905878337 1:41447847-41447869 TCGAGTGCTGGACTCTGGAGAGG + Intergenic
907258078 1:53195436-53195458 TCGAATCCTCCTCTCTTGAGGGG - Intergenic
913293164 1:117294014-117294036 TCTAATCCCAGATTCTTGAGTGG + Intergenic
915174585 1:154004323-154004345 TGTAATCCTGGCATTTTGAGAGG - Intronic
915232240 1:154454244-154454266 TGGAATCCTGGAATCTAGAGTGG + Intronic
916814078 1:168333762-168333784 TCCACTCCTGAAATATTGAGTGG - Intergenic
917665767 1:177223853-177223875 TCGAATCCTGGAGCCTGGGGAGG + Intronic
918788779 1:188799034-188799056 TCAAATCCTGGAAGCTTCAGAGG + Intergenic
920116202 1:203623512-203623534 TGGAATCCAGGGAGCTTGAGGGG + Intergenic
920459434 1:206127930-206127952 AGGCATCCTGGAATCTAGAGAGG + Intergenic
921448832 1:215278815-215278837 TGTAATCCTAGAATTTTGAGAGG - Intergenic
921640972 1:217553699-217553721 TCGAAACCTTGAATCATGTGAGG - Intronic
923787885 1:237085680-237085702 TGGAATCCTGGGAACTTGAGGGG + Intronic
1063311693 10:4958343-4958365 TATAATTCTGGAATTTTGAGGGG - Intronic
1063316100 10:5008127-5008149 TATAATTCTGGAATTTTGAGGGG + Intronic
1063496604 10:6515004-6515026 TCGAATCAGGTAAGCTTGAGGGG - Exonic
1064461843 10:15542203-15542225 TCGAATCTTGCAATTTTGAATGG + Intronic
1065819659 10:29513858-29513880 TTGAATACTGGAATCCTGAAAGG + Intronic
1065953234 10:30670809-30670831 TTGAATATTGGAATCTTGAATGG - Intergenic
1067318735 10:45198156-45198178 GCCAAGCCTGGAATCTGGAGGGG - Intergenic
1070553281 10:77508439-77508461 TCTAATCCTGGAACTTTGGGAGG - Intronic
1070571913 10:77646413-77646435 TAGGATCTTGGACTCTTGAGGGG - Intergenic
1073620697 10:105045000-105045022 TCGAATTCTGGACTTCTGAGTGG - Intronic
1073700567 10:105922156-105922178 TCGGATCATGGAATATTGGGTGG - Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1093511690 12:19936573-19936595 TCAGCTCCTGGAATCTTCAGAGG + Intergenic
1095038405 12:37418973-37418995 GCGACTCCTGGCATCTGGAGAGG + Intergenic
1095469378 12:42520142-42520164 TCCAAACCTGGACACTTGAGAGG - Intronic
1097170267 12:57108867-57108889 TGGAGTCCTAGAATTTTGAGAGG - Intronic
1099885625 12:88526744-88526766 TCTATTCCTGGAATCCTGATTGG - Intronic
1101928878 12:108996109-108996131 TATAATCCTGGCATTTTGAGTGG + Intronic
1106503475 13:30351385-30351407 TGTAATCCTGGCACCTTGAGAGG + Intergenic
1107461322 13:40606567-40606589 TGGAATCCTGGCATTTTGGGAGG - Intronic
1110471189 13:75861999-75862021 ACTAATGCTGGAATCTAGAGGGG - Intergenic
1115494655 14:33991279-33991301 TGTAATCCTAGAATCTTGGGAGG - Intronic
1126673530 15:51137465-51137487 GCCAATCCTGGAGTCTAGAGGGG - Intergenic
1127109783 15:55656194-55656216 TGTAATCCTGGATTCTTGTGGGG - Intronic
1127303003 15:57675978-57676000 TCGAATCCTGGAATCTTGAGTGG + Intronic
1127982399 15:64044958-64044980 TCAAAGCCTGGAATGTAGAGAGG - Intronic
1130230026 15:82089659-82089681 TGGGATCCTGGAATCCTGAGTGG + Intergenic
1132314799 15:100881732-100881754 TGGAGTGCTGGGATCTTGAGTGG + Intronic
1134853283 16:17499445-17499467 TGGAACCCTGGAGGCTTGAGTGG - Intergenic
1136245535 16:28973872-28973894 TGAAATCCTGGAATCTCGTGGGG - Intergenic
1142351422 16:89582538-89582560 TTGAATCAGGGAATCTTGGGGGG + Intronic
1144447716 17:15346172-15346194 TCCAGTCCTAGAATCTTGGGCGG - Intergenic
1148740247 17:49888781-49888803 TGTAATCCTAGCATCTTGAGGGG - Intergenic
1148760546 17:49997539-49997561 TGGAATCCTGGAATCTTGAAAGG + Intergenic
1151957011 17:77385473-77385495 TGTAATCCTGGAACCTTGGGAGG - Intronic
925593450 2:5532569-5532591 TCTAGTCCTAGAAACTTGAGAGG - Intergenic
928204184 2:29272406-29272428 TCCCAGCCTGGAAACTTGAGCGG + Intronic
931609830 2:64086975-64086997 TCAAAATCTGGAATCGTGAGGGG - Intergenic
934104830 2:88685981-88686003 TGGGGTCTTGGAATCTTGAGGGG + Intergenic
936239102 2:110771793-110771815 TCCAATTCTGGAAACTTCAGGGG - Intronic
941921910 2:170859564-170859586 TCATATCCAGGAATCTTCAGGGG - Intronic
945596338 2:211799487-211799509 TTGAATGTTGGCATCTTGAGTGG - Intronic
947506101 2:230709588-230709610 TATAATCCTGGCACCTTGAGAGG - Intergenic
1169471129 20:5886505-5886527 TCTAATCCTAGAATTTTGGGAGG - Intergenic
1169988229 20:11470671-11470693 TCCTATCCTGGAATCTTGGCTGG + Intergenic
1170361735 20:15553674-15553696 TGTAATCCTGGAATTTTGGGAGG - Intronic
1172570390 20:35965760-35965782 TCCAATCCAGTAATTTTGAGTGG + Intronic
1177014002 21:15761466-15761488 TCAAATCCTGGAATCTTATCAGG - Intronic
1177767696 21:25476749-25476771 TGTAATCCTGGAACCTTGGGAGG + Intergenic
1178089334 21:29144600-29144622 ACGAATCGTGGAGTCTTGGGTGG + Intronic
1178668075 21:34566280-34566302 CCTAGTCCTGGAATATTGAGTGG - Intronic
1179809624 21:43862286-43862308 TCTAATCCTGGCATTTTGGGAGG + Intergenic
1180212725 21:46304780-46304802 TGTAAGCCTGGAATCTTGAGCGG + Intronic
1180942935 22:19671567-19671589 TGGAATCTTGGAATCTTGGAAGG - Intergenic
950955094 3:17044420-17044442 ATAAATCCTGGAATCTTGAAAGG - Intronic
951302197 3:21011685-21011707 TTGAATCCTGCTGTCTTGAGAGG - Intergenic
959352446 3:105282667-105282689 TGAAATCATGGTATCTTGAGAGG - Intergenic
960387903 3:117043629-117043651 TCTAATCCCAGAACCTTGAGAGG + Intronic
964525392 3:157611392-157611414 TTGAAACCTGGAAACTTCAGAGG + Intronic
971322520 4:25616826-25616848 TGTAATCCTAGAATTTTGAGAGG + Intergenic
972714530 4:41632488-41632510 TCGAGGCCTTGAATCCTGAGAGG + Intronic
973267775 4:48228640-48228662 TAGAATACTGGGATCTTCAGTGG - Exonic
975906972 4:79225037-79225059 TGGGATCCTGGAATAGTGAGAGG + Intergenic
977356588 4:95954104-95954126 TGGAATCCTGAAAACATGAGTGG + Intergenic
985272712 4:188209322-188209344 TGCAATCCTGGAATATTGTGGGG + Intergenic
987722553 5:21657181-21657203 TGGAATCTTGGAGTCTTAAGAGG + Intergenic
989053465 5:37344081-37344103 TCAAATCCTAGCATTTTGAGAGG + Intronic
995015433 5:107304068-107304090 TGTACTCCTGGAATCCTGAGAGG - Intergenic
1002689855 5:181043325-181043347 TCCCATCATGGAATCTTCAGGGG - Intronic
1002982280 6:2150291-2150313 TCTAATCCTGGCATTTTGGGAGG + Intronic
1003954889 6:11153583-11153605 TCGAATCCTGGAAGCGTGATTGG - Intergenic
1005077364 6:21921513-21921535 TGGAATCCTGGCACTTTGAGAGG + Intergenic
1007850820 6:44801203-44801225 TCGAGTTCTGAAAGCTTGAGTGG - Intergenic
1014270784 6:119333342-119333364 TCGCTTCCTGGAACCTTGAGAGG - Intronic
1014908105 6:127055384-127055406 TGTAATCCTGGCACCTTGAGAGG - Intergenic
1021401279 7:20212523-20212545 TCTTCTCCTGGAAACTTGAGTGG + Intronic
1023196840 7:37650022-37650044 TGTAATCCTAGAATTTTGAGAGG - Intergenic
1023351301 7:39322632-39322654 TCAAATCCTGGATTCTTAGGTGG + Intronic
1026633823 7:72063512-72063534 TAGAGGCCTGGCATCTTGAGTGG + Intronic
1026950958 7:74346464-74346486 TATAATCCTGGCATTTTGAGAGG + Intronic
1029270885 7:99375664-99375686 TAGAATCCTAGCATTTTGAGAGG + Intronic
1032109757 7:129065909-129065931 TGTAATCCTGGAATTTTGGGAGG - Intergenic
1032766403 7:134998259-134998281 TGGAAGCCTGCAAACTTGAGTGG - Intronic
1033773885 7:144584801-144584823 TCAGATACTGGAATCCTGAGCGG + Intronic
1037387113 8:18354971-18354993 TATAATCCTAGAATTTTGAGAGG + Intergenic
1038843588 8:31208806-31208828 TGTAATCCTGGCATTTTGAGAGG - Intergenic
1039760641 8:40570774-40570796 TCAAATCCTGAGATCCTGAGTGG - Intronic
1046592679 8:116225058-116225080 TCAAATCATTGAATCTTTAGGGG + Intergenic
1047004983 8:120610959-120610981 TGGGGTCTTGGAATCTTGAGGGG - Intronic
1057458993 9:95242263-95242285 AAGAATCCTAGAATCTTTAGTGG - Intronic
1060045908 9:120340378-120340400 AGGAATCCTGCAATCTTGTGTGG - Intergenic
1060890006 9:127182079-127182101 TGTAATCCTGGAACTTTGAGAGG + Intronic
1185970422 X:4656037-4656059 TAGAATCCTGGCACTTTGAGAGG + Intergenic
1188626700 X:32293974-32293996 TCCAAGCCTGGAGTCTTGGGTGG + Intronic
1189481970 X:41399024-41399046 TGTAATCCTGGCATTTTGAGAGG - Intergenic
1191936801 X:66435697-66435719 TTGAATCCTGGTATTCTGAGTGG - Intergenic
1192111684 X:68371473-68371495 TCTAATCCTGGCATTTTGGGAGG - Intronic
1194863135 X:99029279-99029301 TGTAATCCTGGAACTTTGAGAGG - Intergenic
1196735792 X:118979848-118979870 TTGCATCCTGGCATCCTGAGAGG - Intronic
1197070475 X:122290880-122290902 TGGAAACCTGTAAACTTGAGTGG + Intergenic