ID: 1127315464

View in Genome Browser
Species Human (GRCh38)
Location 15:57790393-57790415
Sequence TCGGGACAAGCTACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127315464_1127315475 12 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315475 15:57790428-57790450 TCCATTGTTGAGGTTGGGTGGGG No data
1127315464_1127315473 10 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315473 15:57790426-57790448 TGTCCATTGTTGAGGTTGGGTGG No data
1127315464_1127315471 6 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315471 15:57790422-57790444 TACATGTCCATTGTTGAGGTTGG No data
1127315464_1127315472 7 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315472 15:57790423-57790445 ACATGTCCATTGTTGAGGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 141
1127315464_1127315474 11 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315474 15:57790427-57790449 GTCCATTGTTGAGGTTGGGTGGG No data
1127315464_1127315469 2 Left 1127315464 15:57790393-57790415 CCTCCCTCTGTAGCTTGTCCCGA No data
Right 1127315469 15:57790418-57790440 TCCTTACATGTCCATTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127315464 Original CRISPR TCGGGACAAGCTACAGAGGG AGG (reversed) Intergenic