ID: 1127315864

View in Genome Browser
Species Human (GRCh38)
Location 15:57793033-57793055
Sequence CTTCAAGACCTGTTGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127315853_1127315864 28 Left 1127315853 15:57792982-57793004 CCGTCTTCATCACCCAGGGCACC No data
Right 1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG No data
1127315856_1127315864 16 Left 1127315856 15:57792994-57793016 CCCAGGGCACCAAGATGGGACTC No data
Right 1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG No data
1127315859_1127315864 7 Left 1127315859 15:57793003-57793025 CCAAGATGGGACTCCTGTGGCTT No data
Right 1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG No data
1127315862_1127315864 -6 Left 1127315862 15:57793016-57793038 CCTGTGGCTTCTGGAGGCTTCAA No data
Right 1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG No data
1127315857_1127315864 15 Left 1127315857 15:57792995-57793017 CCAGGGCACCAAGATGGGACTCC No data
Right 1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127315864 Original CRISPR CTTCAAGACCTGTTGGAACT CGG Intergenic
No off target data available for this crispr