ID: 1127317599

View in Genome Browser
Species Human (GRCh38)
Location 15:57812691-57812713
Sequence CAATATTAGATCAACCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127317599_1127317606 27 Left 1127317599 15:57812691-57812713 CCTGTATGGTTGATCTAATATTG No data
Right 1127317606 15:57812741-57812763 TTATTATATTGGAGTCTTTTTGG No data
1127317599_1127317607 30 Left 1127317599 15:57812691-57812713 CCTGTATGGTTGATCTAATATTG No data
Right 1127317607 15:57812744-57812766 TTATATTGGAGTCTTTTTGGAGG No data
1127317599_1127317603 16 Left 1127317599 15:57812691-57812713 CCTGTATGGTTGATCTAATATTG No data
Right 1127317603 15:57812730-57812752 GTCTCCCACTGTTATTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127317599 Original CRISPR CAATATTAGATCAACCATAC AGG (reversed) Intergenic
No off target data available for this crispr