ID: 1127318628

View in Genome Browser
Species Human (GRCh38)
Location 15:57820310-57820332
Sequence CCATGGGTGAGGAGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127318617_1127318628 13 Left 1127318617 15:57820274-57820296 CCTCAATGAACTCATCCATTCCA No data
Right 1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG No data
1127318621_1127318628 -7 Left 1127318621 15:57820294-57820316 CCAGGATTATCCAATTCCATGGG No data
Right 1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG No data
1127318619_1127318628 -2 Left 1127318619 15:57820289-57820311 CCATTCCAGGATTATCCAATTCC No data
Right 1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG No data
1127318616_1127318628 14 Left 1127318616 15:57820273-57820295 CCCTCAATGAACTCATCCATTCC No data
Right 1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127318628 Original CRISPR CCATGGGTGAGGAGGAGAGA GGG Intergenic
No off target data available for this crispr