ID: 1127321409

View in Genome Browser
Species Human (GRCh38)
Location 15:57850252-57850274
Sequence CCTACTTTATAAGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127321409_1127321414 13 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321414 15:57850288-57850310 CACTGATGAATGGGGAGAGACGG No data
1127321409_1127321415 20 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321415 15:57850295-57850317 GAATGGGGAGAGACGGCCACAGG No data
1127321409_1127321413 5 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321413 15:57850280-57850302 GAAGACAGCACTGATGAATGGGG No data
1127321409_1127321411 3 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321411 15:57850278-57850300 CAGAAGACAGCACTGATGAATGG No data
1127321409_1127321412 4 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321412 15:57850279-57850301 AGAAGACAGCACTGATGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127321409 Original CRISPR CCTACTTTATAAGCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr