ID: 1127321411

View in Genome Browser
Species Human (GRCh38)
Location 15:57850278-57850300
Sequence CAGAAGACAGCACTGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127321409_1127321411 3 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321411 15:57850278-57850300 CAGAAGACAGCACTGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127321411 Original CRISPR CAGAAGACAGCACTGATGAA TGG Intergenic
No off target data available for this crispr