ID: 1127321415

View in Genome Browser
Species Human (GRCh38)
Location 15:57850295-57850317
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127321409_1127321415 20 Left 1127321409 15:57850252-57850274 CCAGTAGCAGCTTATAAAGTAGG No data
Right 1127321415 15:57850295-57850317 GAATGGGGAGAGACGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127321415 Original CRISPR GAATGGGGAGAGACGGCCAC AGG Intergenic
No off target data available for this crispr