ID: 1127322384

View in Genome Browser
Species Human (GRCh38)
Location 15:57859452-57859474
Sequence TCTACTGCTGTGCCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127322384_1127322388 7 Left 1127322384 15:57859452-57859474 CCTAGTGTGGGCACAGCAGTAGA No data
Right 1127322388 15:57859482-57859504 CCAGATACAGGAGCAGAGCCAGG No data
1127322384_1127322389 8 Left 1127322384 15:57859452-57859474 CCTAGTGTGGGCACAGCAGTAGA No data
Right 1127322389 15:57859483-57859505 CAGATACAGGAGCAGAGCCAGGG No data
1127322384_1127322386 -5 Left 1127322384 15:57859452-57859474 CCTAGTGTGGGCACAGCAGTAGA No data
Right 1127322386 15:57859470-57859492 GTAGAGGTAACGCCAGATACAGG No data
1127322384_1127322390 20 Left 1127322384 15:57859452-57859474 CCTAGTGTGGGCACAGCAGTAGA No data
Right 1127322390 15:57859495-57859517 CAGAGCCAGGGTGAGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127322384 Original CRISPR TCTACTGCTGTGCCCACACT AGG (reversed) Intergenic
No off target data available for this crispr