ID: 1127327127

View in Genome Browser
Species Human (GRCh38)
Location 15:57906612-57906634
Sequence TTGGAAACAGACCACCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127327127_1127327129 -6 Left 1127327127 15:57906612-57906634 CCCTGTTGGTGGTCTGTTTCCAA No data
Right 1127327129 15:57906629-57906651 TTCCAAAATGTTTTCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127327127 Original CRISPR TTGGAAACAGACCACCAACA GGG (reversed) Intergenic
No off target data available for this crispr