ID: 1127327169

View in Genome Browser
Species Human (GRCh38)
Location 15:57906973-57906995
Sequence CCAGGTAAGAAGCTCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127327169_1127327173 4 Left 1127327169 15:57906973-57906995 CCTTCCAGGAGCTTCTTACCTGG No data
Right 1127327173 15:57907000-57907022 AGAAGCTTCAAGAGAAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127327169 Original CRISPR CCAGGTAAGAAGCTCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr