ID: 1127327725

View in Genome Browser
Species Human (GRCh38)
Location 15:57911815-57911837
Sequence CAAACAGAAGTGCTTATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127327719_1127327725 14 Left 1127327719 15:57911778-57911800 CCAGCTGGGGTATATGGGTCAGG No data
Right 1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127327725 Original CRISPR CAAACAGAAGTGCTTATAAA AGG Intergenic
No off target data available for this crispr