ID: 1127329286

View in Genome Browser
Species Human (GRCh38)
Location 15:57922974-57922996
Sequence CAGGATCAGCTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127329277_1127329286 28 Left 1127329277 15:57922923-57922945 CCAGGGGCTGCAAGCTGTGCTTT No data
Right 1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127329286 Original CRISPR CAGGATCAGCTCAGGGAGGA GGG Intergenic
No off target data available for this crispr