ID: 1127329552

View in Genome Browser
Species Human (GRCh38)
Location 15:57925148-57925170
Sequence AAAACAGAAGCTCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127329552_1127329562 19 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329562 15:57925190-57925212 TCATGGGGTAATGGTGATGGTGG No data
1127329552_1127329558 3 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329558 15:57925174-57925196 CCTCAGCTCTTGCAATTCATGGG No data
1127329552_1127329556 2 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329556 15:57925173-57925195 GCCTCAGCTCTTGCAATTCATGG No data
1127329552_1127329559 4 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329559 15:57925175-57925197 CTCAGCTCTTGCAATTCATGGGG No data
1127329552_1127329561 16 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329561 15:57925187-57925209 AATTCATGGGGTAATGGTGATGG No data
1127329552_1127329560 10 Left 1127329552 15:57925148-57925170 CCTGCCTCCTGAGCTTCTGTTTT No data
Right 1127329560 15:57925181-57925203 TCTTGCAATTCATGGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127329552 Original CRISPR AAAACAGAAGCTCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr